answersLogoWhite

0

New York actresses born in 1961?

User Avatar

Anonymous

∙ 16y ago
Updated: 8/17/2019

Nina Arvesen

User Avatar

Wiki User

∙ 16y ago
Copy

What else can I help you with?

Related Questions

When was Wammo born?

Wammo was born in 1961, in New York City, New York, USA.


When was Linda Manz born?

Linda Manz was born in 1961, in New York City, New York, USA.


When was Henry Cotto born?

Henry Cotto was born on January 5, 1961, in New York, New York, USA.


When was Hilary Shepard born?

Hilary Shepard was born in c. 1961, in New York City, New York, USA.


When was Elen Costa born?

Elen Costa was born on November 22, 1961, in New York City, New York, USA.


When was Laurence Schwartz born?

Laurence Schwartz was born on September 7, 1961, in New York City, New York, USA.


When was Candace Silvers born?

Candace Silvers was born on May 27, 1961, in New York City, New York, USA.


When was Cathy Silvers born?

Cathy Silvers was born on May 27, 1961, in New York City, New York, USA.


When was Sean Rule born?

Sean Rule was born on April 6, 1961, in New York City, New York, USA.


When was Sam Robards born?

Sam Robards was born on December 16, 1961, in New York City, New York, USA.


When was Lawrence Robbins born?

Lawrence Robbins was born on June 3, 1961, in New York City, New York, USA.


When was Victoria Talbot born?

Victoria Talbot was born on June 8, 1961, in New York City, New York, USA.

Trending Questions
How do dolphins stay warm in antarctica? Where should I place my hands on the piano to play effectively? What is congestive heart failure? Diffenrences between supply management and supply chain management? Who makes the radio for Mazda cx-9? When did Yun Bo-seon die? Is there a higher rating than rated M for video games? What says SUGAR in Tamil Language? What are hacks for moshi monsters? How do you open a bank account? What is the meaning of shaft resonance? Who invented scalar triangle? How does an Amazon Parrot defend itself? What is the DNA chromosome called that breaks off and reattaches to a homologous chromosome that is paired up in meiosis? What role did freedom of speech and the press play in the abolition movement? What part of speech is s somewhere? What is an instrument that detects radiation by means of an eledtric current? What two numbers can been times together to make 189? Can off duty NYPD Officers wear piercings? What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.