answersLogoWhite

0

Tapi kemel-mode service provider

User Avatar

Anonymous

∙ 12y ago
Updated: 8/18/2019

fax capabilities

User Avatar

Wiki User

∙ 12y ago
Copy

What else can I help you with?

Related Questions

When was Tapi district created?

Tapi district was created in 2007.


When did Dharma Rao Tapi die?

Dharma Rao Tapi died in 1973.


When was Tapi Dharma Rao born?

Dharma Rao Tapi was born in 1887, in Behrampur, India.


When was Tapi Chanakya born?

Tapi Chanakya was born in 1925, in Vijayanagaram, Andhra Pradesh, India.


Tapi River Located in Surat?

The Tapi river is a river in central India, in Gujarat passing from Surat and Songadh.


When was Teva Active Pharmaceutical Ingredients - TAPI - created?

Teva Active Pharmaceutical Ingredients - TAPI - was created in 1901.


What are the tributaries of tapi?

The Tributaries of river tapi are Purna, Girna, Panzara and Waghur.There may b some more


What is the drainage pattern of the river Tapi river?

The Tapi River drains into the Arabian Sea. The Arabian Sea is located in the Middle East, just south of the nation of Yemen.


Which river is located in surat?

Tapi


Which is not a west flowing river?

tapi


Mapi and tapi?

MAPI stands for Messaging Application Programming Interface while TAPI stands for Telephony Application Programming Interface. MAPI is an interface that simulates an exchange server's operations while TAPI is used to connect a telephone to a computer.


Which river rises in betul district of MP and flows westwards?

Tapi bd0f893c-08d3-4876-9484-04e4f7f6db65 1.03.01

Trending Questions
Can musk turtles live with red eared sliders? What is 59kilos in stones and pounds? What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA? What is the computer game RC Laser Warrior? Explain how manifest destiny influenced the westward exoansion of the united states in the 1800s? What are the release dates for Behind the Headlights - 2004 James Dean? How does climate affect the outcome of history? What does it mean when water is condensed? What is the orgin of handkerchief head? Will anybody give me free players or coins on fifa 13 ultimate team? Who is the individual responsible for all incident activities including the developement of strategies and tactics and the ordering and release of resources? How old do you have to be to buy a scope? When did Rabindranath Tagore write kingdom of cards? What title is given to eldest son of british throne? Continental crust are? What was the goal of macon's bill 2? What changes have occured in daintree rainforest? Who was Gerald Nye? Are Prince Philip and Queen Elizabeth related? What causes slow hair growth in the armpit?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.