0
What else can I help you with?
Related Questions
Gentlemenly top commander of the confederate army?
Robert E. Lee
Gentelmanly top commander of the confederate army?
Robert E. Lee
Was George Washington commander in chief of the Confederate army?
George Washington was commander-in-chief of the Continental army (Revolutionary War). The Confederate army fought for the South during the Civil War.
Who was the commander of army of the confederate state?
general lee
Who was the commander of the conferate army?
General Robert E. Lee commanded the Confederate Army and Jefferson Davis was the Confederate President.
Who was the commander of the confederate states of America during the civil war?
The commander (president) of the Confederacy itself was Jefferson Davis. The commander of the Confederate Army was Robert E. Lee.
Commander of confederate army?
General Robert E. Lee
What was the commander of the confederate army of northern Virginia?
gino tubman
Who was the commander of the army for Confederate states?
Robert E. Lee
Who was final commander of the confederate Army?
Robert E. Lee
Who was the commander or the confederate army?
General Robert E. Lee
Who was head of confederate forces?
Commander of the Confederate Army was Robert E. Lee.Secretary of the Confederate Navy was Stephen Mallory.
Trending Questions
Ano ang klaseng pagkain ang bawal na pagkain sa pusa?
How common are Ehlers Danlos syndromes?
What was the name of the first motor car?
Are there bugs on my skin?
What does devoted to a religion mean?
What is writing a fraction as an equivalent fraction with a larger denominator called?
What is 70 percent of 630?
Are Mario and Chris rock brothers?
Why are there no nerve endings in articular cartilage?
What age is Jo brand?
How much does a 2004 ferrari enzo cost?
How can you mine in Minecraft Pocket Editon?
Are you mad or nah?
Why did john Adams asserted that Jefferson plagiarized the declaration of independence from the works of which philosopher?
When does dratini evolve into a dragonair in Pokemon leaf green?
What is a quarter to seven?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
What is the Royal Danish Ballet's Website?
What is the length of a triangle that has a 40 inch hypotnuse and a 90 degree angle?
What is the correct spelling of the singular possessive form of falcons?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.