0
What else can I help you with?
Related Questions
What beats physic Pokemon?
With another physic Pokemon
Physic Pokemon are weekend by what in Pokemon emerald?
physic Pokemon are weakend by dark
What Pokemon can learn the move doom desire in Pokemon white version?
JIRACHI and only jirachi can learn it because only physic and steel together can make this move
How do you beat weezing?
Use a physic or ground type pokemon. However as must ground are not affective, a physic pokemon is ideal
What Pokemon can beat physic?
all of them;) jk my grass type Pokemon kicks ... against physic, others could disagree
What type of Pokemon is Uxie?
physic
What type of Pokemon is mewtew?
physic
What beats physics?
With another physic Pokemon
What type of Pokemon can beat lapras?
physic
Pokemon episode 22 of seson 1?
Abra and the physic Pokemon
What is week against poochyena in Pokemon ruby?
physic type pokemon.
What is the best Pokemon to use on physic Pokemon?
bug,ghost,or dark
Trending Questions
Tattoos that represent travel?
Which of the events was most influential in bringing the US into the world war 2?
What were the elements and functions of god myths?
Give two types of evidence for continental drift with an example of each type?
When you rate their depression on a scale from 1-10. their response are what in your study?
What is the distance between the points (1 -2) and (-93) on a grid?
Why were marriages arranged in Shakespeare's time?
Why does carbon conduct electricity if it is a non metal?
What should you do if the application of one Combat Application Trouniquet does not stop bleeding?
What is minimum age of a imam?
Would mung bean grow without water?
How many amps does a one horse power motor draw?
How long will it take to run 1.5 miles at 7 miles per hour?
Is sign language a forgen language?
What language do Wales people talk?
What is a catchy title for a science fair project on heat?
What words have the same vowel sound as the word ground?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
What is the common name for the spine?
How many people use health app from their cell phone?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.