What actors and actresses appeared in Monogramma - 2005?

Anonymous

∙ 11y ago

Updated: 8/21/2019

The cast of Monogramma - 2005 includes: Manolis Mitsias as himself Dimitris Nanopoulos as himself Giorgos Sgourakis as Himself - Presenter Mikis Theodorakis as himself

Wiki User

∙ 11y ago

What else can I help you with?

What actors and actresses appeared in In - 2005?

The cast of In - 2005 includes: Tamara Simcic

What actors and actresses appeared in Tarps - 2005?

The cast of Tarps - 2005 includes: Inese

What actors and actresses appeared in Yelelo - 2005?

The cast of Yelelo - 2005 includes: Parthiban

What actors and actresses appeared in Hosobe You with you - 2005?

The cast of Hosobe You with you - 2005 includes: You Hosobe

What actors and actresses appeared in commandN - 2005?

The cast of commandN - 2005 includes: Amber MacArthur as (2005)

What actors and actresses appeared in Retrocereales - 2005?

The cast of Retrocereales - 2005 includes: Carmen Lage

What actors and actresses appeared in Me - By Myself - 2005?

The cast of Me - By Myself - 2005 includes: Swati Sengupta

What actors and actresses appeared in BrainSStorm - 2005?

The cast of BrainSStorm - 2005 includes: Tadeusz Pasternak

What actors and actresses appeared in Babel - 2005?

The cast of Babel - 2005 includes: Florinda Loureiro

What actors and actresses appeared in Rutina - 2005?

The cast of Rutina - 2005 includes: Rafael Cortes

What actors and actresses appeared in Damaged - 2005?

The cast of Damaged - 2005 includes: Kurtis Green

What actors and actresses appeared in Ocura - 2005?

The cast of Ocura - 2005 includes: Michael Wehrhahn

Trending Questions

Is the gogli aperatus the same thing as the gogli complex? How many tens are there in 220? What is a famous quote of baron von stuebon? If a guy you like gives you a back rub does this mean he like you? What is a good love song for a forty-fifth wedding anniversary? What day of the week was June 11 1975? The body of water east of the Everett Mountains and on Baffin Island? How do you know what mate is the right one for you? When uranium-238 is transformed into thorium-234 it is represented by a balanced equation What is missing from the equation of U-238 undergoing radioactive decay? What is the zip code for Wisconsin Rapids Wisconsin? How much are Pro dancers supposed to weigh? What is the formula for matter? What inspired Natalie babbitt to begin write stories? How can conditioned beer be properly stored to maintain its quality and flavor? What nicknames does Richard Denson go by? He supported a national bank and protective tariffs? What is the weight of a sheep's heart? What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa? What are the practical implications of a material having a low modulus of elasticity? What role does cell division play with a starfish?