0
What else can I help you with?
Related Questions
What bear is when a grizzly and polar bear breed together?
The bear that will change to that is pizzly, prizzly or grolar bear.
Grizzly bear can run as fast as the average what?
No; a grizzly bear can run about 30 MPH. A horse can run about 40 MPH. Horse speed can vary by breed, however.
How much does a grizzly bear hide weigh?
It would depend on the species and age of the bear.
Which organism is most specialized Amoeba Bacteria Grizzly bear Beetle?
Grizzly bear
Which one is taller a polar bear or a grizzly bear?
A Grizzly Bear is big but, if you measure them side by side, the Polar Bear is seven inches taller than the Grizzly Bear.
Is grizzly bear poisonous?
Grizzly bear is not poisonous.
What is the California state animal?
It's the grizzly bear
Who would win a grizzly bear or a wolverine?
Grizzly bear, by far.
What is nick name of grizzly bear?
it's name is the brown bear, grizzly bear and teddy bear are nicknames for it.
What colour are grizzly bears?
The colors of a grizzly bear are black and/or brown.
Will a grizzly bear eat a dead grizzly bear?
No, they do not eat dead grizzlies.
What animal is called grizzly?
A certain type of bear is called a grizzly bear.
Trending Questions
What is the scientific notation of 7435?
Should you trust the answers on this side?
Are badgers decomposers?
When was Scooter Shooter created?
Who is Tice Davids?
What is the proper salutation to more than one doctor?
What is southern Portugal's weather like in January?
Where do celebrities hide?
Are plecostomus good algae eaters?
What did Petrarch believe?
Is Jeff Fatt a grandfather?
If you get married and then your sister gets married to your husband's brother is that legal?
Lyrics of bahay kubo with accent symbol?
Where is the timing chain located on a 1999 Plymouth breeze?
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
Vitamina d de 5000 unt secundariosefectos?
90 Dodge colt where is the fuel pump located?
Can hypnosis be used to stop bleeding?
When did Lesley Wareing die?
What Bank Branch has the sort code 60-02-35?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.