0
Video Games and Sprots are very popular in Quebec.
What else can I help you with?
Related Questions
What is Quebecs old Name?
New France
What fruits grow on quebecs farms?
chocolate
What bay is located in quebecs northern region?
Hudson?
What is Quebecs capitol?
Quebec city is the capital of Quebec
What is Quebecs current population?
The population of Quebec is about 7,900,000.
What is quebecs size in square kilometer?
1,542,056 km2
What is Quebecs area?
183,890 miles
What is Quebecs official language?
Quebec's official language is French.
What is Quebecs natural resoures?
A natural resources is a star and lumber.
How did the snowy owl become quebecs national bird?
idkki need the answer too :(
What conflicts have occurred because of Quebecs Idependance movement?
chages daliy actives
What is quebecs national plant?
The hemp plant which is also known as Marijuana, can be smoked and eaten.
Trending Questions
Is there a recall on 2006 PT cruiser?
Where do you go to get a permit to put up a fence in LA?
What is the mRNA strand for ggctatatcctgcgctatacgcta?
In legend of Zelda spirit tracks I cannot reach the ice temple stamp station my boomerang does not reach the icy fire in that room how do I get the stamp?
Which Ohio State Football player is called Animal?
Worsted system and woolen system?
What is another name for a tire's height?
How many days old are you today if you were born March 8 1949?
Is ohm's law applicable to ac or dc and why?
Son and daughter of Ferdinand Magellan?
How big is Selena gomez's mole?
What is the value of a 2003 US dollar coin?
Animals in trenches?
Does Minnesota have tolls on its roads?
What is 147 square feet converted to square meters?
Is this statement true premiums for term life insurance decrease as people get older?
What should I do if my toilet has a weak flush?
When was Mann Kee Awaaz Pratigya created?
What is the recipricol of 7654321?
What is the unit price of a product?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.