answersLogoWhite

0

What are Quebec's hobbies?

User Avatar

Anonymous

∙ 10y ago
Updated: 8/18/2019

Video Games and Sprots are very popular in Quebec.

User Avatar

Wiki User

∙ 10y ago
Copy

What else can I help you with?

Related Questions

What is Quebecs old Name?

New France


What fruits grow on quebecs farms?

chocolate


What bay is located in quebecs northern region?

Hudson?


What is Quebecs capitol?

Quebec city is the capital of Quebec


What is Quebecs current population?

The population of Quebec is about 7,900,000.


What is quebecs size in square kilometer?

1,542,056 km2


What is Quebecs area?

183,890 miles


What is Quebecs official language?

Quebec's official language is French.


What is Quebecs natural resoures?

A natural resources is a star and lumber.


How did the snowy owl become quebecs national bird?

idkki need the answer too :(


What conflicts have occurred because of Quebecs Idependance movement?

chages daliy actives


What is quebecs national plant?

The hemp plant which is also known as Marijuana, can be smoked and eaten.

Trending Questions
Is there a recall on 2006 PT cruiser? Where do you go to get a permit to put up a fence in LA? What is the mRNA strand for ggctatatcctgcgctatacgcta? In legend of Zelda spirit tracks I cannot reach the ice temple stamp station my boomerang does not reach the icy fire in that room how do I get the stamp? Which Ohio State Football player is called Animal? Worsted system and woolen system? What is another name for a tire's height? How many days old are you today if you were born March 8 1949? Is ohm's law applicable to ac or dc and why? Son and daughter of Ferdinand Magellan? How big is Selena gomez's mole? What is the value of a 2003 US dollar coin? Animals in trenches? Does Minnesota have tolls on its roads? What is 147 square feet converted to square meters? Is this statement true premiums for term life insurance decrease as people get older? What should I do if my toilet has a weak flush? When was Mann Kee Awaaz Pratigya created? What is the recipricol of 7654321? What is the unit price of a product?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.