0
DNA Adenine with Thymine, Guanine with Cytosine
RNA Adenine with Uracil, Guanine with Cytosine
What else can I help you with?
What bases found in DNA but not in RNA?
Uracil is found in RNA but not in DNA.
What is found in DNA and RNA?
DNA and RNA both have a sugar-phosphate backbone and nitrogenous bases. The bases found in both DNA and RNA are Adenine, Guanine and Cytosine.
What is found in both RNA and DNA?
DNA and RNA both have a sugar-phosphate backbone and nitrogenous bases. The bases found in both DNA and RNA are Adenine, Guanine and Cytosine.
What are the bases for RNA?
The bases for RNA are Adenine, Guanine, Uracil and Cytosine. A, G and C are exactly the same as in DNA. Uracil in RNA replaces Thymine in DNA.
What is a difference between rna and dna molecules?
One of the bases of RNA is uracil while one of the bases of DNA is thymine.
What base is different in RNA from the bases in DNA?
Both DNA and RNA each contain the bases adenine, cytosine, and guanine. They differ in that DNA contains thymine whereas RNA contains uracil.
Is there a template for transcribing original DNA to base sequence of RNA?
Yes, to transcribe DNA to RNA, replace thymine (T) in DNA with uracil (U) in RNA. Simply write down the complementary RNA bases to the DNA bases following this rule to transcribe the original DNA sequence to RNA.
How do the nitrogen bases of RNA match up with the bases of DNA during transcription?
During transcription, the nitrogen bases of RNA match up with the bases of DNA through complementary base pairing. Adenine (A) in DNA pairs with uracil (U) in RNA, while cytosine (C) in DNA pairs with guanine (G) in RNA. This pairing occurs as RNA polymerase synthesizes a single strand of RNA using the DNA template strand. The result is a complementary RNA strand that reflects the genetic code carried by the DNA.
Does dna and RNA have nitrogenous bases?
Both DNA and RNA have nitrogenous bases. The nitrogenous bases in DNA are adenine (A), thymine (T), cytosine (C), and guanine (G). The nitrogenous bases in RNA are adenine (A), uracil (U), cytosine (C), and guanine (G). In DNA, A and T pair together, as does C and G. In RNA, C and G also pair together, but A pairs with U because U replaces T in RNA.
Complementary DNA bases for RNA bases?
The complementary DNA bases for RNA bases are: adenine (A) pairs with thymine (T) in DNA, instead of uracil (U) in RNA; cytosine (C) pairs with guanine (G) in both DNA and RNA. So, in DNA: A pairs with T, and C pairs with G, while in RNA: A pairs with U, and C pairs with G.
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
An enzyme that reads along a sequence of bases in DNA making a complementary sequence of nucleotide bases in RNA is?
RNA polymerase is the enzyme that reads along a sequence of bases in DNA and synthesizes a complementary sequence of nucleotide bases in RNA during transcription.
