answersLogoWhite

0

  • English Language
  • Synonyms and Antonyms
  • Prefixes Suffixes and Root Words
  • Compound Words

What are some complementary words?

User Avatar

Wiki User

βˆ™ 2014-09-17 23:12:36

Best Answer
Copy

In contemporary English, 'complementary words' (or, words that support -- or complement -- each other) of all sorts can be found. One large group would be alliterations, whether based on consonants or vowels, such as 'words with 'k-sounds' or 'words beginning with a long 'a-sound'.'

2014-09-17 23:12:36
This answer is:
πŸ€“
🀯
πŸ€”
User Avatar

Add your answer:

Earn +5 pts
Q: What are some complementary words?
Write your answer...
Submit

Related Questions

What are some complementary words beginning with the letter r?

· radiant · rational · ravishing · realistic · reasonable · refined · reliable · remarkable · respectful · resplendent · responsible · righteous


What sequence is complementary to aggtac?

The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.


What are the complementary color?

blue and orange are complementary colors red and green are complementary colors yellow and purple are complementary colors


What are some complementary adjectives starting with the letter y?

youthful


What is a complementary want?

a want that is complementary


What are some complementary adjectives that begin with the letter A?

Able, adorable, amazing, angelic, appreciative, artistic, astute, athletic, attractive and awesome are complementary adjectives.


Are vertical angles always complementary?

Vertical angles are not always complementary. In some cases, they will congruent and supplementary which makes them add up to 180 degrees.


Wha are some disadvantages of complementary and alternative medicine?

you are allgay bastarsd


Blue and red are complementary colors?

no, blue and orange are complementary colors and red and green are complementary colors


What are some disadvantages of complementary and alternative medicine?

Some disadvantages of complementary and alternative medicine is the lack of physicians who practice these areas. Also, if the alternative treatments are not done correctly they could cause increased damage or risk.


Is the complementary angle 49?

Complementary angle to which angle?


What complementary binding is?

basically complementary binding is useless


What is complementary colors?

Two colours are complementary if lights of those colours add to make pure white light. Complementary colours are not the same as complementary pigments (or paints).


Can vertical angles be complementary?

Vertical angles must be congruent so if they are complementary, they must be 45 degrees to be complementary.


What is the complementary sequence for atgcccgggtgtcgtagttga?

For DNA, the complementary base sequence is TACGGGCCCACAGCATCAACT. For mRNA, the complementary base sequence is UACGGGCCCACAGCAUCAACU.


What are some examples of complementary alcoholic drinks?

whiskey wine vodka wikid


What does complementary opposite mean?

yin and yang are complementary opposites


Are milk and cheese complementary goods?

no, milk & cheese are not complementary


Which color is complementary to yellow?

purple is yellow's complementary color


What is a sentence for complementary?

Those garish colors are not very complementary.


Can three angles be complementary?

No only two angles can be complementary


What is the complementary angle of A degree?

90 minus A = complementary angle


What is the complementary angle of 23?

The complementary angle is 67 degrees.


What is the complementary angle of 75?

The complementary angle is 15 degrees.


What is the complementary angle of 83?

The complementary angle is 7 degrees.