answersLogoWhite

0

The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.

User Avatar

Wiki User

10y ago

What else can I help you with?

Related Questions

What is the complementary sequence for atgcccgggtgtcgtagttga?

The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."


What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?

The complementary sequence to ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta is ggatagttagaacaatgctgtgcctcatgtgctccggtataaccattaagaaactattgcaat. It pairs adenine with thymine and cytosine with guanine.


What is the complementary nucleotide sequence of ccgagattg?

The complementary nucleotide sequence of ccgagattg is ggctctaac.


What is complementary sequence?

When DNA and/or RNA are in the double helix configuration each helix is the complementary sequence of the other.


List the two nucleotide sequence that are complementary to the sticky end sequence on the human DNA?

The complementary nucleotide sequence to a sticky end sequence on human DNA would be its reverse complement sequence. For example, if the sticky end sequence is "AATT", its complementary sequence would be "TTAA".


What sequence is the sequence of the complementary strand of DNA?

its tcaa


What is the sequence of complementary strand?

TGCA


If the DNA sequence is TAG what is the sequence of the complementary strand of tRNA?

auc


What is the complementary base sequence of the DNA strand if the template strand reads TTGCACG?

The complementary base sequence of a DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). For the template strand TTGCACG, the complementary sequence would be AACGTGC.


Which base sequence in DNA is complementary to the base sequence atgt?

ATAGCC is complementary to the base sequence TATCGG.


What would be the base sequence of the complementary mRNA strand?

TGCA


What is the complementary DNA base sequence for the following bases AACT?

The complementary DNA base sequence for AACT is TTGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original sequence is replaced by its complementary base.