0
The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.
Wiki User
∙ 9y ago
Add your answer:
Earn +20 pts
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What would be the base sequence of the complementary mRNA strand?
TGCA
What is the complementary sequence for this DNA c-t-a-a-g-t-c?
To find the complementary sequence for a given DNA sequence, you need to match each nucleotide with its complementary base according to the base-pairing rules. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Given the DNA sequence: C - T - A - A - G - T - C The complementary sequence would be: G - A - T - T - C - A - G
What is the sequence of the complementary DNA strand gaattcggca?
Simple you just look at what base it is then what ever base would be complementary to it, is your answer. ATTGTCCAGT is your answer
Which is the complimentary dna sequence to 5' atgcatgtca 3'?
5' TGACATGCAT 3' The sequence is complementary and in the correct orientation.
What is complementary sequence?
When DNA and/or RNA are in the double helix configuration each helix is the complementary sequence of the other.
What sequence is the sequence of the complementary strand of DNA?
its tcaa
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What is the sequence of complementary strand?
TGCA
If the DNA sequence is TAG what is the sequence of the complementary strand of tRNA?
auc
What would be the base sequence of the complementary mRNA strand?
TGCA
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
What is it called when copying part of a nucleotide sequence of dna into a complementary sequence in rna?
transcription
What is the complementary base sequence of cagttagc-oh?
A binds with T, C binds with G. Therefore the complementary DNA sequence will be GTCAATCG. The complementary RNA would be CAGTTAGC. The OH means it is the 3' end - so the complementary strand would be 5' at the same spot.
What is the sequence of complementary nucleotides?
Ggc tct aac
What is the complementary base sequence of DNA strand?
TGCA
What sequence in human DNA is the forward primer complementary to?
forward primers are complementary to anti sense strand of the dsDNA
