0
What else can I help you with?
What sequence of DNA bases bonds with the DNA base sequent ATGT?
TACA
DNA sequence acgtt will give what mRNA base sequence?
The mRNA base sequence corresponding to the DNA sequence acgtt is ugcaa. The mRNA sequence is complementary to the DNA sequence, with thymine (T) in DNA being replaced by uracil (U) in mRNA.
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
The complementary DNA sequence to CGGCCTTCAATAGGTCCCAAA is GCCGGAAGTTATCCAGGGTTT. In DNA, adenine pairs with thymine and guanine pairs with cytosine, so in the complementary sequence, each base is replaced by its complement.
During DNA replication what sequence on complementary base pairs will be match to the following sequence ATACGCGTTA?
ji
In a DNA molecule what base sequence is complementary to the sequence CGAC?
The base sequence complementary to CGAC in a DNA molecule is GCTG. In DNA, cytosine (C) pairs with guanine (G), and adenine (A) pairs with thymine (T), so you would replace each base with its complementary counterpart. Therefore, C pairs with G, G pairs with C, A pairs with T, and C pairs with G.
What sequence of DNA bases bonds with the DNA base sequence atgt?
The complementary DNA base sequence that would bond with ATGT is TACA. In DNA, adenine pairs with thymine, and guanine pairs with cytosine. This follows the base pairing rules of DNA.
What sequence of DNA base bonds with DNA base sequence ATGT?
TACA
What sequence of DNA bases with the DNA base sequence atgt?
TACA
What sequence of DNA bases bonds with the DNA base sequence ATGT.?
TACA
What sequence of DNA bases bonds with the DNA base sequent ATGT?
TACA
What sequence of DNA bases bonds with the DNA bases sequence atgt?
TACA
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
What is the complementary base sequence of DNA strand?
TGCA
What is CCGTAGGCC?
CCGTAGGCC is a sequence of DNA base pairs. It represents the complementary DNA strand to the original sequence GGCTACGG, where each base pairs with its complementary base (A with T and C with G).
What would be the base sequence for the complementary DNA formed from CGT TA?
The base sequence for the complementary DNA would be GCA AT. Since DNA strands are complementary, the bases pair as follows: A with T, T with A, C with G, and G with C.
DNA sequence acgtt will give what mRNA base sequence?
The mRNA base sequence corresponding to the DNA sequence acgtt is ugcaa. The mRNA sequence is complementary to the DNA sequence, with thymine (T) in DNA being replaced by uracil (U) in mRNA.
What is the dna segment of ugauuc from mRNA?
The DNA segment complementary to the mRNA sequence "UGAUUC" would be "ACTAAG". This is because in DNA, adenine pairs with thymine and cytosine pairs with guanine. Thus, the complementary DNA sequence of the mRNA sequence is determined by replacing each base with its complementary base.
