answersLogoWhite

0

ATAGCC is complementary to the base sequence TATCGG.

User Avatar

Wiki User

11y ago

What else can I help you with?

Related Questions

What sequence of DNA bases bonds with the DNA base sequence atgt?

The complementary DNA base sequence that would bond with ATGT is TACA. In DNA, adenine pairs with thymine, and guanine pairs with cytosine. This follows the base pairing rules of DNA.


What sequence of DNA base bonds with DNA base sequence ATGT?

TACA


What sequence of DNA bases with the DNA base sequence atgt?

TACA


What sequence of DNA bases bonds with the DNA base sequence ATGT.?

TACA


What sequence of DNA bases bonds with the DNA base sequent ATGT?

TACA


What sequence of DNA bases bonds with the DNA bases sequence atgt?

TACA


What is the complementary DNA base sequence for the following bases AACT?

The complementary DNA base sequence for AACT is TTGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original sequence is replaced by its complementary base.


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."


What is the complementary base sequence of DNA strand?

TGCA


What is CCGTAGGCC?

CCGTAGGCC is a sequence of DNA base pairs. It represents the complementary DNA strand to the original sequence GGCTACGG, where each base pairs with its complementary base (A with T and C with G).


What would be the base sequence for the complementary DNA formed from CGT TA?

The base sequence for the complementary DNA would be GCA AT. Since DNA strands are complementary, the bases pair as follows: A with T, T with A, C with G, and G with C.


What is the base sequence of the original DNA segment?

To determine the base sequence of the original DNA segment, you would need to know the complementary base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). If you have a sequence of the complementary DNA strand, you can reverse the pairs to identify the original sequence. Without the specific complementary sequence provided, the original DNA segment cannot be determined.