TGCA
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
The complementary DNA strand to TAC-CGG-AGT is ATG-GCC-TCA. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G), so the complementary strand is created by matching these base pairs.
CCGTAGGCC is a sequence of DNA base pairs. It represents the complementary DNA strand to the original sequence GGCTACGG, where each base pairs with its complementary base (A with T and C with G).
The base sequence CAGACT corresponds to the DNA strand, and it would be complementary to the RNA strand with the sequence GUCUGA. Therefore, the original strand is the DNA strand.
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
TGCA
The DNA base pairing rules are A-T and C-G, so the complementary strand to TAGTCA is ATCAGT.
tcaa --remember a attracts t while c attracts g
its tcaa
If one strand of DNA has a nucleotide base sequence of tcaggtccat, its complementary strand is agtccaggta. Adenine pairs with thymine, while guanine pairs with cytosine.
The complementary DNA strand would be AGC CTG GTA GCT. In DNA, adenine pairs with thymine and cytosine pairs with guanine. Therefore, the complementary strand is formed by replacing each base with its complementary base.
A TG CAGATTCTCTAAG