answersLogoWhite

0

TGCA

What else can I help you with?

Related Questions

Complementary dna sequence?

A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.


The nucleotide base sequence of a strand of DNA is TAC-CGG-AGT. What is the sequence of the complementary DNA strand?

The complementary DNA strand to TAC-CGG-AGT is ATG-GCC-TCA. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G), so the complementary strand is created by matching these base pairs.


What is CCGTAGGCC?

CCGTAGGCC is a sequence of DNA base pairs. It represents the complementary DNA strand to the original sequence GGCTACGG, where each base pairs with its complementary base (A with T and C with G).


A fragment of a strand of nucleic acid isolated from a silk moth species contains the base sequence CAGACT The strand must be from?

The base sequence CAGACT corresponds to the DNA strand, and it would be complementary to the RNA strand with the sequence GUCUGA. Therefore, the original strand is the DNA strand.


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."


What would be the base sequence of the complementary mRNA strand?

TGCA


What complementary strand to the DNA sequence TAGTCA is?

The DNA base pairing rules are A-T and C-G, so the complementary strand to TAGTCA is ATCAGT.


A strand of dna contains the base sequence AGTTwhat is the sequence of the complementary strand of DNA?

tcaa --remember a attracts t while c attracts g


What sequence is the sequence of the complementary strand of DNA?

its tcaa


If one strand of DNA has a nucleotide base sequence of tcaggtccat?

If one strand of DNA has a nucleotide base sequence of tcaggtccat, its complementary strand is agtccaggta. Adenine pairs with thymine, while guanine pairs with cytosine.


A gene has the base sequence that starts with TCG GAC CAT CGA a) What would be the complementary DNA strand formed from this DNA ing?

The complementary DNA strand would be AGC CTG GTA GCT. In DNA, adenine pairs with thymine and cytosine pairs with guanine. Therefore, the complementary strand is formed by replacing each base with its complementary base.


What is the sequence of the base os agctcag on the opposite strand?

A TG CAGATTCTCTAAG