A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.
The complementary strand of this DNA sequence is... A T G C T A A C C
The DNA segment complementary to the mRNA sequence "UGAUUC" would be "ACTAAG". This is because in DNA, adenine pairs with thymine and cytosine pairs with guanine. Thus, the complementary DNA sequence of the mRNA sequence is determined by replacing each base with its complementary base.
The base sequence for the complementary DNA would be GCA AT. Since DNA strands are complementary, the bases pair as follows: A with T, T with A, C with G, and G with C.
its tcaa
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
When DNA and/or RNA are in the double helix configuration each helix is the complementary sequence of the other.
The complementary DNA sequence to CGGCCTTCAATAGGTCCCAAA is GCCGGAAGTTATCCAGGGTTT. In DNA, adenine pairs with thymine and guanine pairs with cytosine, so in the complementary sequence, each base is replaced by its complement.
The complementary nucleotide sequence to a sticky end sequence on human DNA would be its reverse complement sequence. For example, if the sticky end sequence is "AATT", its complementary sequence would be "TTAA".
auc
The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.
The complementary DNA base sequence for AACT is TTGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original sequence is replaced by its complementary base.
DNA polymerase is the enzyme responsible for replicating DNA by adding complementary nucleotides in the correct sequence during DNA synthesis.
TGCA
The complementary strand of this DNA sequence is... A T G C T A A C C
The DNA segment complementary to the mRNA sequence "UGAUUC" would be "ACTAAG". This is because in DNA, adenine pairs with thymine and cytosine pairs with guanine. Thus, the complementary DNA sequence of the mRNA sequence is determined by replacing each base with its complementary base.