answersLogoWhite

0

TGCA

What else can I help you with?

Related Questions

What is the complementary sequence for atgcccgggtgtcgtagttga?

The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."


What is the complementary base sequence of DNA strand?

TGCA


What is the sequence of the base os agctcag on the opposite strand?

A TG CAGATTCTCTAAG


What is the sequence of the complementary DNA strand gaattcggca?

The complementary DNA strand for "gaattcggca" would be "cttaagccgt." In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). So you would replace each base according to these rules to find the complementary sequence.


A fragment of a strand of nucleic acid isolated from a silk moth species contains the base sequence CAGACT The strand must be from?

The base sequence CAGACT corresponds to the DNA strand, and it would be complementary to the RNA strand with the sequence GUCUGA. Therefore, the original strand is the DNA strand.


Complementary dna sequence?

A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.


A gene has the base sequence that starts with TCG GAC CAT CGA a) What would be the complementary DNA strand formed from this DNA ing?

The complementary DNA strand would be AGC CTG GTA GCT. In DNA, adenine pairs with thymine and cytosine pairs with guanine. Therefore, the complementary strand is formed by replacing each base with its complementary base.


If one strand of DNA has a nucleotide base sequence of tcaggtccat?

If one strand of DNA has a nucleotide base sequence of tcaggtccat, its complementary strand is agtccaggta. Adenine pairs with thymine, while guanine pairs with cytosine.


Which base sequence would be found on the complentary strand of DNA?

If the base sequence on one strand of DNA is A-T-G-C, then the complementary strand would have the sequence T-A-C-G. In DNA, adenine pairs with thymine and guanine pairs with cytosine.


What letters would form the other strand of the helix?

In DNA, the other strand of the helix would have complementary base pairs to the original strand. Adenine pairs with thymine, and cytosine pairs with guanine. So, if one strand has the sequence ATTGC, the complementary strand would be TAACG.


What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?

I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.


What is the base sequence along the complementary region of the other strand of the double helix if one is GAATGC?

The complementary sequence to GAATGC is CTTACG. In DNA, adenine pairs with thymine, so if one strand has a guanine (G), the complementary strand will have a cytosine (C); and if one strand has an adenine (A), the complementary strand will have a thymine (T).

Trending Questions
How many platelets does the average human being have? How does the development of MSRA illustrate how adaptation and natural selection can lead to the development of new strains of microorganisms? The cell membrane then pinches in two to form two daughter cells What is the term describing this process? An injury in which superficial layers of the skin are scraped or rubbed away is known as? What does this mean Worn so that one may see better? What are discomforts of hemmorhoids? What is the difference between niche and habitat? What plant physical structure or organ has a similar function to the internal skeleton of an animal Stamen Bark Stem Pistil? What is the best molecular biology textbook available for comprehensive learning and understanding of the subject? What example is Two populations that are separated by a mountain range can no longer interbreed to produce fertile offspring.? Why can't I shut my right eye while keeping my left eye open? Do tissues make up cells? How do molecules have energy? The pI of a lysozyme is 11. What is the pH range in which the overall charge of the lysozyme is positive? What is the actual number of ATP produced from complete oxidation of one molecule of glucose? Only gram positive organism name ending in 'ella? Does large seeds germinate faster than small seeds? What are the dangers of brain surgery? How should I care for pink rain lilies to ensure they thrive and bloom beautifully? What is the weight per foot of 2 x 4 Douglas fir board?