0
TGCA
What else can I help you with?
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
What is the sequence of the base os agctcag on the opposite strand?
A TG CAGATTCTCTAAG
What is the sequence of the complementary DNA strand gaattcggca?
The complementary DNA strand for "gaattcggca" would be "cttaagccgt." In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). So you would replace each base according to these rules to find the complementary sequence.
A fragment of a strand of nucleic acid isolated from a silk moth species contains the base sequence CAGACT The strand must be from?
The base sequence CAGACT corresponds to the DNA strand, and it would be complementary to the RNA strand with the sequence GUCUGA. Therefore, the original strand is the DNA strand.
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What is the complementary base sequence of the DNA strand if the template strand reads TTGCACG?
The complementary base sequence of a DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). For the template strand TTGCACG, the complementary sequence would be AACGTGC.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
What base sequence would be produced through TAGGTAACT?
The base sequence produced from the DNA strand TAGGTAACT would be its complementary strand. In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). Therefore, the complementary sequence would be ATCCATTGA.
What is the complementary base sequence of DNA strand?
TGCA
What is the base sequence on the other strand?
To determine the base sequence on the complementary DNA strand, you need to know the base sequence of one strand. DNA is composed of four bases: adenine (A), thymine (T), cytosine (C), and guanine (G). The complementary base pairing rules state that A pairs with T and C pairs with G. For example, if the given strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'.
What is the sequence of the base os agctcag on the opposite strand?
A TG CAGATTCTCTAAG
What is the sequence of the complementary DNA strand gaattcggca?
The complementary DNA strand for "gaattcggca" would be "cttaagccgt." In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). So you would replace each base according to these rules to find the complementary sequence.
A fragment of a strand of nucleic acid isolated from a silk moth species contains the base sequence CAGACT The strand must be from?
The base sequence CAGACT corresponds to the DNA strand, and it would be complementary to the RNA strand with the sequence GUCUGA. Therefore, the original strand is the DNA strand.
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
A gene has the base sequence that starts with TCG GAC CAT CGA a) What would be the complementary DNA strand formed from this DNA ing?
The complementary DNA strand would be AGC CTG GTA GCT. In DNA, adenine pairs with thymine and cytosine pairs with guanine. Therefore, the complementary strand is formed by replacing each base with its complementary base.
If one strand of DNA has a nucleotide base sequence of tcaggtccat?
If one strand of DNA has a nucleotide base sequence of tcaggtccat, its complementary strand is agtccaggta. Adenine pairs with thymine, while guanine pairs with cytosine.
Which base sequence would be found on the complentary strand of DNA?
If the base sequence on one strand of DNA is A-T-G-C, then the complementary strand would have the sequence T-A-C-G. In DNA, adenine pairs with thymine and guanine pairs with cytosine.
