0
What else can I help you with?
An original DNA strand has the following base sequence ACGTAAGCT What base sequence would be produced through transcription?
During transcription, the DNA sequence ACGTAAGCT is translated into a complementary RNA sequence. The base pairing rules dictate that adenine (A) pairs with uracil (U) in RNA instead of thymine (T) found in DNA. Thus, the RNA sequence produced would be UGCAUUCGAA.
What base sequence would be produced through transcription ACGTAAGCT?
gaugcgauccguaaucugaccau
What is the mrna produced in a t t c g a c c t a c g?
The mRNA sequence produced from the DNA sequence "ATTCGACCTACG" would be "UAAGCUGGAUGC." This is achieved through the process of transcription, where RNA polymerase reads the DNA template and synthesizes a complementary mRNA strand.
What strand of mRNA would be produced of GCA TTA?
The strand of mRNA produced from the DNA sequence GCA TTA would be complementary to the DNA template strand. The corresponding mRNA sequence would be CUG AAU, where adenine (A) pairs with uracil (U) in RNA, cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C).
What DNA strand would be produced with tac gg?
The DNA strand produced from the template sequence "tac gg" would be complementary to it. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, the complementary DNA strand would be "atg cc."
An original DNA strand has the following base sequence ACGTAAGCT What base sequence would be produced through transcription?
During transcription, the DNA sequence ACGTAAGCT is translated into a complementary RNA sequence. The base pairing rules dictate that adenine (A) pairs with uracil (U) in RNA instead of thymine (T) found in DNA. Thus, the RNA sequence produced would be UGCAUUCGAA.
What base sequence would be produced through transcription ACGTAAGCT?
gaugcgauccguaaucugaccau
What would be the complimentary sequence of bases produced by a DNA strand with bases CTGCCA?
The sequence would be GACGGT
Which of these is the correct mRNA that would be produced from this segment of DNA tactaggctaat?
The correct mRNA sequence that would be produced from the DNA sequence "tactaggctaat" is "auguccgcuuau". This is because in mRNA, thymine (T) is replaced by uracil (U) and the complementary mRNA sequence is produced from the DNA template during transcription.
What amino acid would be produced if transcription took place from the DNA sequence CAT?
Transcription of the DNA sequence CAT would produce the messenger RNA sequence CAU. This mRNA sequence would then be translated by ribosomes to produce the amino acid histidine.
How would the amino acid sequence produced by the mutant strand compare to the amino acid sequence produced by series 1?
The mutant strand would likely have a different amino acid sequence compared to series 1 due to the mutation in the DNA sequence. The mutant strand may result in changes in the protein structure and function if the mutation leads to a substitution, deletion, or insertion of a nucleotide in the coding region of the gene.
What is the mrna produced in a t t c g a c c t a c g?
The mRNA sequence produced from the DNA sequence "ATTCGACCTACG" would be "UAAGCUGGAUGC." This is achieved through the process of transcription, where RNA polymerase reads the DNA template and synthesizes a complementary mRNA strand.
Explain why the addition of an extra base in a DNA sequence would change the message carried by a DNA molecule?
The addition of an extra base in a DNA sequence would cause a frameshift mutation, shifting the reading frame of the genetic code. This would alter the codons specifying amino acids in the protein sequence, leading to a different protein being produced.
What strand of mRNA would be produced of GCA TTA?
The strand of mRNA produced from the DNA sequence GCA TTA would be complementary to the DNA template strand. The corresponding mRNA sequence would be CUG AAU, where adenine (A) pairs with uracil (U) in RNA, cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C).
What will be produced by DNA replication if the DNA molecule is a-t-t-c-g-g-a-a-t-g-g-a-a-t-c-c-c-g?
On its own, nothing. It has no start codon (TAC). Even assuming that this is just a section in the middle of a codon, the first is a stop. It says; stop-alanine-glycine-cysteine This sequence is total nonsense.
What is the order of sequence the structures of the urine would normally pass through?
Urine typically passes through the following structures in order: first, it is produced in the kidneys, where it is collected in the renal pelvis. From the renal pelvis, urine flows through the ureters to the bladder, where it is stored until ready for excretion. Finally, urine is expelled from the body through the urethra.
What DNA strand would be produced with tac gg?
The DNA strand produced from the template sequence "tac gg" would be complementary to it. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, the complementary DNA strand would be "atg cc."
