0
What else can I help you with?
What base sequence would be produced through transcription ACGTAAGCT?
gaugcgauccguaaucugaccau
What is the mrna produced in a t t c g a c c t a c g?
The mRNA sequence produced from the DNA sequence "ATTCGACCTACG" would be "UAAGCUGGAUGC." This is achieved through the process of transcription, where RNA polymerase reads the DNA template and synthesizes a complementary mRNA strand.
What strand of mRNA would be produced of GCA TTA?
The strand of mRNA produced from the DNA sequence GCA TTA would be complementary to the DNA template strand. The corresponding mRNA sequence would be CUG AAU, where adenine (A) pairs with uracil (U) in RNA, cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C).
If the DNA sequence is GAT what is the sequence of the complementary strand of DNA?
If reading the DNA in the same direction ie 5' to 3' it would be ATC, however when bound to the complement it would sit in the reverse order - 3' to 5' and would read CTA.
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
What base sequence would be produced through transcription ACGTAAGCT?
gaugcgauccguaaucugaccau
What would be the complimentary sequence of bases produced by a DNA strand with bases CTGCCA?
The sequence would be GACGGT
Which of these is the correct mRNA that would be produced from this segment of DNA tactaggctaat?
The correct mRNA sequence that would be produced from the DNA sequence "tactaggctaat" is "auguccgcuuau". This is because in mRNA, thymine (T) is replaced by uracil (U) and the complementary mRNA sequence is produced from the DNA template during transcription.
What amino acid would be produced if transcription took place from the DNA sequence CAT?
Transcription of the DNA sequence CAT would produce the messenger RNA sequence CAU. This mRNA sequence would then be translated by ribosomes to produce the amino acid histidine.
How would the amino acid sequence produced by the mutant strand compare to the amino acid sequence produced by series 1?
The mutant strand would likely have a different amino acid sequence compared to series 1 due to the mutation in the DNA sequence. The mutant strand may result in changes in the protein structure and function if the mutation leads to a substitution, deletion, or insertion of a nucleotide in the coding region of the gene.
What is the mrna produced in a t t c g a c c t a c g?
The mRNA sequence produced from the DNA sequence "ATTCGACCTACG" would be "UAAGCUGGAUGC." This is achieved through the process of transcription, where RNA polymerase reads the DNA template and synthesizes a complementary mRNA strand.
Explain why the addition of an extra base in a DNA sequence would change the message carried by a DNA molecule?
The addition of an extra base in a DNA sequence would cause a frameshift mutation, shifting the reading frame of the genetic code. This would alter the codons specifying amino acids in the protein sequence, leading to a different protein being produced.
What will be produced by DNA replication if the DNA molecule is a-t-t-c-g-g-a-a-t-g-g-a-a-t-c-c-c-g?
On its own, nothing. It has no start codon (TAC). Even assuming that this is just a section in the middle of a codon, the first is a stop. It says; stop-alanine-glycine-cysteine This sequence is total nonsense.
What is the new mRNA stand produced by this mutated gene?
The specific sequence of the new mRNA strand produced by a mutated gene will depend on the nature of the mutation. Mutations can cause changes in the coding region of the gene, leading to alterations in the mRNA sequence and potentially affecting the resulting protein or gene function. Further analysis and sequencing of the mutated gene would be required to determine the exact mRNA sequence.
Which mutation would not change the remainder of the reading frame of a gene sequence that follows the mutation?
A silent mutation, where a nucleotide substitution results in a codon that codes for the same amino acid, would not change the remainder of the reading frame of a gene sequence. This is because the amino acid sequence produced by the altered codon remains the same.
If the DNA sequence is GAT what is the sequence of the complementary strand of DNA?
If reading the DNA in the same direction ie 5' to 3' it would be ATC, however when bound to the complement it would sit in the reverse order - 3' to 5' and would read CTA.
What is a nth term in a sequence?
Well, it would depend what the sequence was...? If the sequence was 2,4,6,8,10,12,14,16,18,20, then the 9th term would be 18!
