answersLogoWhite

0

The strand of mRNA produced from the DNA sequence GCA TTA would be complementary to the DNA template strand. The corresponding mRNA sequence would be CUG AAU, where adenine (A) pairs with uracil (U) in RNA, cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C).

User Avatar

AnswerBot

2mo ago

What else can I help you with?

Continue Learning about Natural Sciences

What strand of RNA would be produced from the GCA TTA strand?

The RNA strand produced from the DNA template strand GCA TTA would be complementary and antiparallel. Therefore, the corresponding mRNA sequence would be CUG AAU, as adenine (A) pairs with uracil (U) in RNA, and cytosine (C) pairs with guanine (G).


Which strand of mRNA would be made during transcription using the DNa strand shown below. GCA TAG?

During transcription, the mRNA strand is synthesized complementary to the DNA template strand. Given the DNA strand "GCA TAG," the corresponding mRNA strand would be "CUG AUC," where each DNA base pairs with its RNA complement (G with C, C with G, A with U, and T with A).


Which strand of mRNA would be made during transcription using the DNA strand shown below GCA TTA?

During transcription, the mRNA strand is synthesized complementary to the DNA template strand. For the DNA strand GCA TTA, the corresponding mRNA would be CGU AAU. This is because adenine (A) pairs with uracil (U) in RNA, while cytosine (C) pairs with guanine (G) and vice versa.


A T C G G A what would the complimentary mRNA strand read?

The Rna triplet codon GUA, Thymine being replaced by Uracil in all Rna's.


Ask us would be the strand of complementary DNA produced by the strand of DNA shown below CGT ATA?

The complementary DNA strand produced from the given DNA sequence "CGT ATA" would be "GCA TAT." In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is replaced by its complementary base in the new strand.

Related Questions

What strand of RNA would be produced from the GCA TTA strand?

The RNA strand produced from the DNA template strand GCA TTA would be complementary and antiparallel. Therefore, the corresponding mRNA sequence would be CUG AAU, as adenine (A) pairs with uracil (U) in RNA, and cytosine (C) pairs with guanine (G).


What strand mrna would be produced from the strand of DNA gca tta?

UGA CUG


Which strand of mRNA would be made during transcription using the DNa strand shown below. GCA TAG?

During transcription, the mRNA strand is synthesized complementary to the DNA template strand. Given the DNA strand "GCA TAG," the corresponding mRNA strand would be "CUG AUC," where each DNA base pairs with its RNA complement (G with C, C with G, A with U, and T with A).


Which strand of mRNA would be made during transcription using the DNA strand shown below GCA TTA?

During transcription, the mRNA strand is synthesized complementary to the DNA template strand. For the DNA strand GCA TTA, the corresponding mRNA would be CGU AAU. This is because adenine (A) pairs with uracil (U) in RNA, while cytosine (C) pairs with guanine (G) and vice versa.


What complementary strands of DNA would be produced from the strand of DNA?

Gca-tat gca ta The answer is AGC CT cat gt


What strand of DNA would be produced from from the template strand of DNA shown below?

Ttg ga


What strand of mRNA would be produced from the strand of DNA shown below?

The DNA strand CAT-TAG would produce a complementary mRNA strand of GUA-AUC.


A T C G G A what would the complimentary mRNA strand read?

The Rna triplet codon GUA, Thymine being replaced by Uracil in all Rna's.


Ask us would be the strand of complementary DNA produced by the strand of DNA shown below CGT ATA?

The complementary DNA strand produced from the given DNA sequence "CGT ATA" would be "GCA TAT." In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is replaced by its complementary base in the new strand.


What should the strand of complementary DNA produced by cgt ata?

The complementary DNA strand produced from the sequence "cgt ata" would be "gca tat." In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base to form the new strand.


What DNA would be produced by the strand cgt ata?

The DNA strand complementary to the sequence "cgt ata" would be "gca tat." In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, the complementary bases for each nucleotide in the original strand are matched accordingly.


What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?

During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC