answersLogoWhite

0

The DNA strand complementary to the sequence "cgt ata" would be "gca tat." In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, the complementary bases for each nucleotide in the original strand are matched accordingly.

User Avatar

AnswerBot

1mo ago

What else can I help you with?

Continue Learning about Natural Sciences

Ask us would be the strand of complementary DNA produced by the strand of DNA shown below CGT ATA?

The complementary DNA strand produced from the given DNA sequence "CGT ATA" would be "GCA TAT." In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is replaced by its complementary base in the new strand.


What should the strand of complementary DNA produced by cgt ata?

The complementary DNA strand produced from the sequence "cgt ata" would be "gca tat." In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base to form the new strand.


What does the complimentary strand look like for ccc-cga-ata?

The complimentary strand for ccc-cga-ata would be ggg-gct-tat. This is because DNA base pairing rules dictate that cytosine pairs with guanine and adenine pairs with thymine in DNA molecules.


What amino acid wuld be produced of transcrition takes place from a nucleotide with the three-base sequence ATA?

Tyrosine. If ATA is the DNA codon, the mRNA transcription would be UAU (since A pairs with U in RNA rather than T). UAU codes for tyrosine.


What are the three types of mutation?

The three types of mutations are substitution (a single nucleotide is replaced with a different one), insertion (an extra nucleotide is added to the DNA sequence), and deletion (a nucleotide is removed from the DNA sequence).

Related Questions

Ask us would be the strand of complementary DNA produced by the strand of DNA shown below CGT ATA?

The complementary DNA strand produced from the given DNA sequence "CGT ATA" would be "GCA TAT." In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is replaced by its complementary base in the new strand.


What should the strand of complementary DNA produced by cgt ata?

The complementary DNA strand produced from the sequence "cgt ata" would be "gca tat." In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base to form the new strand.


Which strand of mrna would be made during transcription using the DNA strand ctg ata?

gac uau Gac uau GAC UAU


What does the complimentary strand look like for ccc-cga-ata?

The complimentary strand for ccc-cga-ata would be ggg-gct-tat. This is because DNA base pairing rules dictate that cytosine pairs with guanine and adenine pairs with thymine in DNA molecules.


What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?

During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC


What would be the stand of complementary dna produced by the strand of dna shown below cgt ata?

Gca-tat gca ta The answer is AGC CT cat gt


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."


What is the untranscribed DNA tac ttt ttc tgg ata aag gcg ctc cgg ata ccc ccg ttc auu?

aug aaa aag aac uau uuc cgc gag ggc uau ggg ggc aac aag uua


What amino acid wuld be produced of transcrition takes place from a nucleotide with the three-base sequence ATA?

Tyrosine. If ATA is the DNA codon, the mRNA transcription would be UAU (since A pairs with U in RNA rather than T). UAU codes for tyrosine.


What are the three types of mutation?

The three types of mutations are substitution (a single nucleotide is replaced with a different one), insertion (an extra nucleotide is added to the DNA sequence), and deletion (a nucleotide is removed from the DNA sequence).


Tyrosine anticodon is AUA what is DNA base triplet for its codon?

The DNA base triplet that corresponds to the AUA codon in mRNA is TAT.


What are four ATA standards for interfacing with hard drives?

paralell ata ,serial ata, eide,ultra ata...etc paralell ata ,serial ata, eide,ultra ata...etc paralell ata ,serial ata, eide,ultra ata...etc paralell ata ,serial ata, eide,ultra ata...etc paralell ata ,serial ata, eide,ultra ata...etc