The DNA strand complementary to the sequence "cgt ata" would be "gca tat." In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, the complementary bases for each nucleotide in the original strand are matched accordingly.
The complementary DNA strand produced from the given DNA sequence "CGT ATA" would be "GCA TAT." In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is replaced by its complementary base in the new strand.
The complementary DNA strand produced from the sequence "cgt ata" would be "gca tat." In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base to form the new strand.
The complimentary strand for ccc-cga-ata would be ggg-gct-tat. This is because DNA base pairing rules dictate that cytosine pairs with guanine and adenine pairs with thymine in DNA molecules.
Tyrosine. If ATA is the DNA codon, the mRNA transcription would be UAU (since A pairs with U in RNA rather than T). UAU codes for tyrosine.
The three types of mutations are substitution (a single nucleotide is replaced with a different one), insertion (an extra nucleotide is added to the DNA sequence), and deletion (a nucleotide is removed from the DNA sequence).
The complementary DNA strand produced from the given DNA sequence "CGT ATA" would be "GCA TAT." In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is replaced by its complementary base in the new strand.
The complementary DNA strand produced from the sequence "cgt ata" would be "gca tat." In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base to form the new strand.
gac uau Gac uau GAC UAU
The complimentary strand for ccc-cga-ata would be ggg-gct-tat. This is because DNA base pairing rules dictate that cytosine pairs with guanine and adenine pairs with thymine in DNA molecules.
Gca-tat gca ta The answer is AGC CT cat gt
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
aug aaa aag aac uau uuc cgc gag ggc uau ggg ggc aac aag uua
Tyrosine. If ATA is the DNA codon, the mRNA transcription would be UAU (since A pairs with U in RNA rather than T). UAU codes for tyrosine.
The three types of mutations are substitution (a single nucleotide is replaced with a different one), insertion (an extra nucleotide is added to the DNA sequence), and deletion (a nucleotide is removed from the DNA sequence).
The DNA base triplet that corresponds to the AUA codon in mRNA is TAT.
paralell ata ,serial ata, eide,ultra ata...etc paralell ata ,serial ata, eide,ultra ata...etc paralell ata ,serial ata, eide,ultra ata...etc paralell ata ,serial ata, eide,ultra ata...etc paralell ata ,serial ata, eide,ultra ata...etc