0
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
Wiki User
∙ 12y ago
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA).
An A on the DNA template is complementary to a U on the mRNA, T to A and C to G.
Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is:
UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
Wiki User
∙ 12y ago
Wiki User
∙ 11y agoThe DNA strand ATG-AAC-GTA would create the complementary RNA strand UAC-UUG-CAU.
A binds to U, T binds to A, C binds to G and G binds to C.
Add your answer:
Earn +20 pts
The strand of DNA that encodes the RNA molecule during transcription is the?
Template Strand
MRNA strand is made in the process of what?
mRNA is produced during the process of transcription, in which mRNA makes a complimentary copy of the DNA code.
What is the enzyme that binds and separates the DNA strands during transcription?
single-strand binding proteins
Translation is to protein as transcription is to?
DNA strand
Which strand of mrna would be made during transcription using the DNA strand ctg ata?
gac uau Gac uau GAC UAU
The strand of DNA that encodes the RNA molecule during transcription is the?
Template Strand
Which strand of DNA transcribes into mRNA?
The strand running in the 3'-5' end will be the one that RNA copies, as this is the direction of transcription
What molecule builds the new strand of RNA during transcription?
RNA Polymerase plays the largest role in unzipping the DNA strand and then synthesizing the RNA strand.
Which stand of mRNA would be made during transcription using the DNA. Strand?
GCUAGA :)
MRNA strand is made in the process of what?
mRNA is produced during the process of transcription, in which mRNA makes a complimentary copy of the DNA code.
Transcription makes a complementary strand of the DNA?
This Process Is Called DNA Transcription. *Apex*
The manufacture of a strand of RNA complementary to a strand of DNA is termed?
Transcription
What is the assembly of an RNA strand?
Transcription
Process of synthesizing an RNA strand from a DNA template strand?
The synthesis of mRNA from DNA is called transcription.
How many strands of DNA are used for transcription?
No, just one strand, the coding strand is used to create a mRNA molecule in the process of transcription.
Synthesis of M-RNA strand from DNA strand inside nucleus?
Transcription
What is the enzyme that binds and separates the DNA strands during transcription?
single-strand binding proteins
