0
Which strand of mrna would be made during transcription using the DNA strand ctg ata?
Wiki User
∙ 8y ago
gac uau
Gac uau
GAC UAU
Wiki User
∙ 8y ago
melinda pack
GAC UAU IS CORRECT FOR APEX
Add your answer:
Earn +20 pts
Which strand of mRNA would be made during transcription using the DNA strand shown below AGC GCT?
the DNA strand GTT ACC would be transcribed to CAA UGG.
Which strand of mrna would be made during transcription using the dna strand gat ccg?
Ucg cga GAC UAU
Which strand of mrna would be made during transcription using the dna strand gat ccc?
Gcu aga
What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?
The strand is called the parental strand. the gene being copied would depend on which protein is needed.
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
Which stand of mRNA would be made during transcription using the DNA. Strand?
GCUAGA :)
Which strand of mRNA would be made during transcription using the DNA strand shown below AGC GCT?
the DNA strand GTT ACC would be transcribed to CAA UGG.
Which strand of mrna would be made during transcription using the dna strand gat ccg?
Ucg cga GAC UAU
Which strand of mrna would be made during transcription using the dna strand gat ccc?
Gcu aga
What would be the mrna base sequence formed during transcription using the DNA sequence below?
Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.
What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?
The strand is called the parental strand. the gene being copied would depend on which protein is needed.
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
What steps happen first during during transcription?
At first during transcription, RNA polymerase binds the promoter region of a gene to be transcribed. The end product would be the synthesized mRNA.
What does RNA polymerase use one strand of DNA as?
No. All strands can be replicated, just depends on where the enzyme decides to land and unzip it. Anyways, all DNA molecules would be adequate templates since they are all identical copies of each other.
What is the possible effects of an error during transcription?
A possible effect on an error during transcription is that a nonfunctioning protein will be produced. The protein would be made of the wrong amino acids (and wrong shape).
Does during DNA replication only one strand of DNA serve as a template?
No. All strands can be replicated, just depends on where the enzymne decides to land and unzip it. Anyways, all DNA molecules would be adequate templates since they are all identical copies of each other.
The complimentary strand or matchig strand of DNA for tagtca would be?
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
