0
Which strand of mrna would be made during transcription using the dna strand gat ccc?
Gcu aga
What else can I help you with?
Which strand of mrna would be made during transcription using the dna strand gat ccg?
Ucg cga GAC UAU
Which strand of mRNA would be made during transcription using the DNA strand shown below AGC GCT?
the DNA strand GTT ACC would be transcribed to CAA UGG.
Which strand of mrna would be made during transcription using the DNA strand ctg ata?
gac uau Gac uau GAC UAU
What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?
The template strand of DNA is used to make a complementary copy during DNA replication, while the antisense (non-coding) strand is used as a template for complementary mRNA synthesis during transcription.
What happens first during transcription?
RNA polymerase reaches the beginning of the gene
Which stand of mRNA would be made during transcription using the DNA. Strand?
GCUAGA :)
Which strand of mrna would be made during transcription using the dna strand gat ccg?
Ucg cga GAC UAU
Which strand of mRNA would be made during transcription using the DNA strand shown below AGC GCT?
the DNA strand GTT ACC would be transcribed to CAA UGG.
Which strand of mrna would be made during transcription using the DNA strand ctg ata?
gac uau Gac uau GAC UAU
What would be the mrna base sequence formed during transcription using the DNA sequence below?
Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.
What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?
The template strand of DNA is used to make a complementary copy during DNA replication, while the antisense (non-coding) strand is used as a template for complementary mRNA synthesis during transcription.
What happens first during transcription?
RNA polymerase reaches the beginning of the gene
Why both strands of DNA are not copied during transcription?
During transcription, only one DNA strand is used as a template to synthesize an mRNA molecule. This strand is called the template or antisense strand. The other DNA strand, known as the coding or sense strand, is not used because it has the same sequence as the mRNA molecule being produced, except with thymine instead of uracil. Transcribing both strands would be redundant and energetically wasteful.
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
What strand of DNA would be produced from the template strand of DNA?
AAC CT would produce TTG GA The coding strand is the DNA strand that has the same base sequence as the RNA transcript. It contains codons, and the non-coding strand has anti-codons instead.
What does RNA polymerase use one strand of DNA as?
No. All strands can be replicated, just depends on where the enzyme decides to land and unzip it. Anyways, all DNA molecules would be adequate templates since they are all identical copies of each other.
What steps happen first during during transcription?
At first during transcription, RNA polymerase binds the promoter region of a gene to be transcribed. The end product would be the synthesized mRNA.
