0
Which strand of mrna would be made during transcription using the dna strand gat ccg?
Wiki User
∙ 10y ago
Verified answer
Ucg cga
GAC UAU
Wiki User
∙ 7y ago
_issiah. gonzales
Kevin Greenfelder
The mRNA strand would be CGU AUC.
Wiki User
∙ 12y agoThe mRNA strand would be CGU AUC.
Wiki User
∙ 10y agoCua ggc
ymmrs
_issiah. gonzales
CGU AUC
Haven Walter
Lulu Pfannerstill
Emma Affeldt
Wiki User
∙ 11y agoCgu auc
Which strand of mRNA would be made during transcription using the DNA strand shown below AGC GCT?
the DNA strand GTT ACC would be transcribed to CAA UGG.
Which strand of mrna would be made during transcription using the DNA strand ctg ata?
gac uau Gac uau GAC UAU
Which strand of mrna would be made during transcription using the dna strand gat ccc?
Gcu aga
What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?
The strand is called the parental strand. the gene being copied would depend on which protein is needed.
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
Which stand of mRNA would be made during transcription using the DNA. Strand?
GCUAGA :)
Which strand of mRNA would be made during transcription using the DNA strand shown below AGC GCT?
the DNA strand GTT ACC would be transcribed to CAA UGG.
Which strand of mrna would be made during transcription using the DNA strand ctg ata?
gac uau Gac uau GAC UAU
Which strand of mrna would be made during transcription using the dna strand gat ccc?
Gcu aga
What would be the mrna base sequence formed during transcription using the DNA sequence below?
Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.
What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?
The strand is called the parental strand. the gene being copied would depend on which protein is needed.
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
What steps happen first during during transcription?
At first during transcription, RNA polymerase binds the promoter region of a gene to be transcribed. The end product would be the synthesized mRNA.
What does RNA polymerase use one strand of DNA as?
No. All strands can be replicated, just depends on where the enzyme decides to land and unzip it. Anyways, all DNA molecules would be adequate templates since they are all identical copies of each other.
What is the possible effects of an error during transcription?
A possible effect on an error during transcription is that a nonfunctioning protein will be produced. The protein would be made of the wrong amino acids (and wrong shape).
Does during DNA replication only one strand of DNA serve as a template?
No. All strands can be replicated, just depends on where the enzymne decides to land and unzip it. Anyways, all DNA molecules would be adequate templates since they are all identical copies of each other.
Where does the cell carry out transcription?
During protein synthesis transcription takes place early in the process in the nucleus of the cell when RNA is generated from DNA. After the processed RNA leaves the nucleus it is used to create a protein product through the process of translation.
