0
What else can I help you with?
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.
What is the airport code for Aurukun Airport?
The airport code for Aurukun Airport is AUU.
What anticodon matches the codon cuc?
The anticodon sequence would be GAG-UUC-ACG-AAG.
What are the names of two or three native trees that produce berries in the UK?
hahahahha auu aihcid gvasoghiadsv
How many people from one school can you have for AAU boys basketball?
how ever many the coach wants to have because they usually choose the teams
What would be the sequence of the complimentary DNA strand for this gene atc gtt aac gca?
The complementary base of A is T, and the complementary base of G is C. So if there is an T the complementary would be A, and if there is a C the complementary would be a G and so on. Therefore the complementary strand would be: G A A T C C G A A T G G T.
What is the first codon of the mRNA ccuagaauuggcc?
A codon is a 3-base long sequence. Therefore the first codon in CCU-AGA-AUU- GGC-C is CCU. CCU codes for the amino acid Proline.
What amino acid is coded for by the codon AUC?
The anticodon would be UAG, and the amino acid coded for is isoleucine.
If the sequence of bases in mRNA is UUU UUA AUU GUC CCA the sequence of amino acids in the polypeptide will be?
The sequence of amino acids in the polypeptide will be Phenylalanine-Leucine-Isoleucine-Valine-Proline. This is because each group of three mRNA bases (codon) corresponds to a specific amino acid, as determined by the genetic code.
Amino acid sequence for ctg ggc tta aag cgc?
Due to the calculations you make using your genetic code dictionaries, you must go backwards using the third letter of codon and then second and then first. Then, you have your answer for what the amino acid sequence would be for cga gaa guc. Then you just flip cga and guc, keeping gaa in the middle.
What is the amino acid sequence that is coded for the mRNA sequence AUG-ACG-AAA-AGA-AGG-GGA-GCC-GCU-UCC-UAA?
The amino acid sequence is: UUU-UCU-UCC-CCU-CGG-CGA-AGG-AUU.
What is the importance of the codons in protein synthesis?
A codon is the triplet sequence in the messenger RNA (mRNA) transcript which specifies a corresponding amino acid (or a start or stop command). An anticodon is the corresponding triplet sequence on the transfer RNA (tRNA) which brings in the specifieds amino acid to the ribosome during translation. The anticodon is complementary to the codon, that is, if the codon is AUU, then the anticodon is UAA. No Thymine's in mRNA. It's replaced by Uranine
