0
What else can I help you with?
What strand of mRNA would be produced of GCA TTA?
The strand of mRNA produced from the DNA sequence GCA TTA would be complementary to the DNA template strand. The corresponding mRNA sequence would be CUG AAU, where adenine (A) pairs with uracil (U) in RNA, cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C).
Which strand of mRNA would be made during transcription using the DNa strand shown below. GCA TAG?
During transcription, the mRNA strand is synthesized complementary to the DNA template strand. Given the DNA strand "GCA TAG," the corresponding mRNA strand would be "CUG AUC," where each DNA base pairs with its RNA complement (G with C, C with G, A with U, and T with A).
Which strand of mRNA would be made during transcription using the DNA strand shown below GCA TTA?
During transcription, the mRNA strand is synthesized complementary to the DNA template strand. For the DNA strand GCA TTA, the corresponding mRNA would be CGU AAU. This is because adenine (A) pairs with uracil (U) in RNA, while cytosine (C) pairs with guanine (G) and vice versa.
A T C G G A what would the complimentary mRNA strand read?
The Rna triplet codon GUA, Thymine being replaced by Uracil in all Rna's.
What molecule builds the new strand of RNA during transcription?
RNA polymerase builds the new strand of RNA during transcription. It catalyzes the formation of phosphodiester bonds between nucleotides to create the complementary RNA strand based on the DNA template strand.
What strand mrna would be produced from the strand of DNA gca tta?
UGA CUG
What strand of mRNA would be produced of GCA TTA?
The strand of mRNA produced from the DNA sequence GCA TTA would be complementary to the DNA template strand. The corresponding mRNA sequence would be CUG AAU, where adenine (A) pairs with uracil (U) in RNA, cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C).
Which strand of mRNA would be made during transcription using the DNa strand shown below. GCA TAG?
During transcription, the mRNA strand is synthesized complementary to the DNA template strand. Given the DNA strand "GCA TAG," the corresponding mRNA strand would be "CUG AUC," where each DNA base pairs with its RNA complement (G with C, C with G, A with U, and T with A).
What RNA strand is produced from DNA?
messenger RNA (mRNA)
A T C G G A what would the complimentary mRNA strand read?
The Rna triplet codon GUA, Thymine being replaced by Uracil in all Rna's.
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
What strand of DNA of would be produced from the template strand of DNA?
AAC CT would produce TTG GA The coding strand is the DNA strand that has the same base sequence as the RNA transcript. It contains codons, and the non-coding strand has anti-codons instead.
Would 5' atgctatcattgaccttgagttattaa -3' be a strand of DNA or RNA?
This has to be a strand of DNA because RNA does not have Thymine (T), instead it has Uracil (U).Thus, if this strand were RNA it would read:5' augcuaucauugaccuugaguuauuaa 3'
What molecule builds the new strand of RNA during transcription?
RNA polymerase builds the new strand of RNA during transcription. It catalyzes the formation of phosphodiester bonds between nucleotides to create the complementary RNA strand based on the DNA template strand.
How does DNA template dictate the sequence of the RNA produced?
During transcription the DNA double helix is separated into two individual strands. Each strand may serve as a template for RNA polymerase, which travels along the DNA structure in a 3' to 5' direction. As it progresses down the strand, RNA polymerase synthesizes a pre-messenger RNA strand that is complementary to the sequence on the DNA template. For example if the DNA sequence on the template was 5' ATACA 3', then the pre mRNA sequence synthesized would be 3' UAUGU 5'. (Remember, RNA synthesis utilizes the nucleotide uracil instead of thyamine).
What is the replacement for thymine in an RNA strand?
The replacement for thymine in an RNA strand is uracil.
What rna strand is complementary to the DNA strand gtagtca?
As long as the DNA strand sequence "CTAGGTTAC" is in the 5' to 3' position, the correct RNA sequence would be "CUAGGUUAC". RNA is identical to the coding strand, which is always read 5' to 3'. The only difference is U replaces T.
