answersLogoWhite

0

The RNA strand produced from the DNA template strand GCA TTA would be complementary and antiparallel. Therefore, the corresponding mRNA sequence would be CUG AAU, as adenine (A) pairs with uracil (U) in RNA, and cytosine (C) pairs with guanine (G).

User Avatar

AnswerBot

8mo ago

What else can I help you with?

Continue Learning about Natural Sciences

What strand of mRNA would be produced of GCA TTA?

The strand of mRNA produced from the DNA sequence GCA TTA would be complementary to the DNA template strand. The corresponding mRNA sequence would be CUG AAU, where adenine (A) pairs with uracil (U) in RNA, cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C).


Which strand of mRNA would be made during transcription using the DNa strand shown below. GCA TAG?

During transcription, the mRNA strand is synthesized complementary to the DNA template strand. Given the DNA strand "GCA TAG," the corresponding mRNA strand would be "CUG AUC," where each DNA base pairs with its RNA complement (G with C, C with G, A with U, and T with A).


Which strand of mRNA would be made during transcription using the DNA strand shown below GCA TTA?

During transcription, the mRNA strand is synthesized complementary to the DNA template strand. For the DNA strand GCA TTA, the corresponding mRNA would be CGU AAU. This is because adenine (A) pairs with uracil (U) in RNA, while cytosine (C) pairs with guanine (G) and vice versa.


A T C G G A what would the complimentary mRNA strand read?

The Rna triplet codon GUA, Thymine being replaced by Uracil in all Rna's.


If the RNA strand were produced during transcription what amino acids would be found in the protein?

To determine the amino acids in the protein produced from an RNA strand, you need to first translate the RNA sequence into codons, which are groups of three nucleotides. Each codon corresponds to a specific amino acid based on the genetic code. Therefore, the specific amino acids found in the protein depend on the sequence of the RNA strand generated during transcription. Without the actual RNA sequence, it's impossible to specify which amino acids would be present in the resulting protein.

Related Questions

What strand mrna would be produced from the strand of DNA gca tta?

UGA CUG


What strand of mRNA would be produced of GCA TTA?

The strand of mRNA produced from the DNA sequence GCA TTA would be complementary to the DNA template strand. The corresponding mRNA sequence would be CUG AAU, where adenine (A) pairs with uracil (U) in RNA, cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C).


Which strand of mRNA would be made during transcription using the DNa strand shown below. GCA TAG?

During transcription, the mRNA strand is synthesized complementary to the DNA template strand. Given the DNA strand "GCA TAG," the corresponding mRNA strand would be "CUG AUC," where each DNA base pairs with its RNA complement (G with C, C with G, A with U, and T with A).


Which strand of mRNA would be made during transcription using the DNA strand shown below GCA TTA?

During transcription, the mRNA strand is synthesized complementary to the DNA template strand. For the DNA strand GCA TTA, the corresponding mRNA would be CGU AAU. This is because adenine (A) pairs with uracil (U) in RNA, while cytosine (C) pairs with guanine (G) and vice versa.


What RNA strand is produced from DNA?

messenger RNA (mRNA)


A T C G G A what would the complimentary mRNA strand read?

The Rna triplet codon GUA, Thymine being replaced by Uracil in all Rna's.


What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?

During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC


What strand of DNA of would be produced from the template strand of DNA?

AAC CT would produce TTG GA The coding strand is the DNA strand that has the same base sequence as the RNA transcript. It contains codons, and the non-coding strand has anti-codons instead.


Would 5' atgctatcattgaccttgagttattaa -3' be a strand of DNA or RNA?

This has to be a strand of DNA because RNA does not have Thymine (T), instead it has Uracil (U).Thus, if this strand were RNA it would read:5' augcuaucauugaccuugaguuauuaa 3'


If the RNA strand were produced during transcription what amino acids would be found in the protein?

To determine the amino acids in the protein produced from an RNA strand, you need to first translate the RNA sequence into codons, which are groups of three nucleotides. Each codon corresponds to a specific amino acid based on the genetic code. Therefore, the specific amino acids found in the protein depend on the sequence of the RNA strand generated during transcription. Without the actual RNA sequence, it's impossible to specify which amino acids would be present in the resulting protein.


How does the nucleated sequence of the coding strand of a DNA molecule differ from the RNA produced?

The nucleated sequence of the coding strand of a DNA molecule differs from the RNA produced in that the RNA contains uracil (U) instead of thymine (T). Additionally, during transcription, the RNA is synthesized as a complementary strand, meaning that adenine (A) in the DNA pairs with uracil (U) in the RNA, while cytosine (C) pairs with guanine (G). Furthermore, the RNA molecule is typically single-stranded, whereas the DNA coding strand is part of a double-stranded structure.


What would be the sequence of nucleotides that pair GCA?

The sequence of nucleotides that would pair with GCA is CGT. In DNA, guanine (G) pairs with cytosine (C), and adenine (A) pairs with thymine (T). Therefore, for the RNA sequence, GCA would pair with CGU, where uracil (U) replaces thymine.