messenger RNA (mRNA)
The nucleated sequence of the coding strand of a DNA molecule differs from the RNA produced in that the RNA contains uracil (U) instead of thymine (T). Additionally, during transcription, the RNA is synthesized as a complementary strand, meaning that adenine (A) in the DNA pairs with uracil (U) in the RNA, while cytosine (C) pairs with guanine (G). Furthermore, the RNA molecule is typically single-stranded, whereas the DNA coding strand is part of a double-stranded structure.
gaucgaucacucaggacuaug
The RNA strand produced from the DNA template strand GCA TTA would be complementary and antiparallel. Therefore, the corresponding mRNA sequence would be CUG AAU, as adenine (A) pairs with uracil (U) in RNA, and cytosine (C) pairs with guanine (G).
During transcription, RNA polymerase uses the template strand of DNA to create a complementary RNA strand.
During transcription the DNA double helix is separated into two individual strands. Each strand may serve as a template for RNA polymerase, which travels along the DNA structure in a 3' to 5' direction. As it progresses down the strand, RNA polymerase synthesizes a pre-messenger RNA strand that is complementary to the sequence on the DNA template. For example if the DNA sequence on the template was 5' ATACA 3', then the pre mRNA sequence synthesized would be 3' UAUGU 5'. (Remember, RNA synthesis utilizes the nucleotide uracil instead of thyamine).
AAC CT would produce TTG GA The coding strand is the DNA strand that has the same base sequence as the RNA transcript. It contains codons, and the non-coding strand has anti-codons instead.
The correct answer is: RNA is synthesized by RNA polymerase that reads one strand of DNA. RNA polymerase reads DNA 3' to 5'. When RNA is made, it is made 5' to 3'. Most polymerases have the 3' to 5' "reading" activity. The created RNA strand is identical to the coding strand of DNA, which is also in the orientation of 5' to 3'.
During transcription, only one side of the DNA, known as the template strand, is used to synthesize RNA. The other side, called the coding strand, has a sequence that matches the RNA produced (except for the substitution of uracil for thymine). This process allows the RNA polymerase enzyme to read the template strand and create a complementary RNA strand.
UGA CUG
MRNA is made by rna polymerase using Dna as a template.
Yes, that's correct. Transcription is the process by which the genetic information in a segment of DNA is used to create a complementary RNA strand. This RNA molecule can then be used to direct the synthesis of proteins in a cell.
The enzyme responsible for decoding the DNA strand into an mRNA is called RNA polymerase. It catalyzes the synthesis of mRNA during transcription by matching complementary RNA nucleotides with the DNA template strand.