answersLogoWhite

0

gaugcgauccguaaucugaccau

User Avatar

Wiki User

∙ 15y ago

What else can I help you with?

Continue Learning about Natural Sciences

An original DNA strand has the following base sequence ACGTAAGCT What base sequence would be produced through transcription?

During transcription, the DNA sequence ACGTAAGCT is translated into a complementary RNA sequence. The base pairing rules dictate that adenine (A) pairs with uracil (U) in RNA instead of thymine (T) found in DNA. Thus, the RNA sequence produced would be UGCAUUCGAA.


How is mRNA produced in a cell?

mRNA is produced through a process called transcription, which occurs in the nucleus of a cell. During transcription, the DNA sequence of a gene is copied into a complementary mRNA sequence by RNA polymerase enzyme. This mRNA transcript is then processed and modified before it is transported out of the nucleus to be translated into protein in the cytoplasm.


Arrangement of nucleotides that determines the sequence of amino acids that will make up the protein?

The arrangement of nucleotides in DNA determines the sequence of amino acids in a protein through the process of transcription and translation. During transcription, RNA is synthesized from DNA, and during translation, the sequence of RNA nucleotides is decoded into a specific sequence of amino acids, forming a protein specified by the DNA sequence.


Where is rRNA produced in a cell?

Unmodified RNA is produced through transcription. Where transcription occurs depends on if the organism is a prokaryote (bacteria or archea) or eukaryote (plant or animal). RNA in prokaryotes is produced inside the cell membrane. RNA in eukaryotes is produced inside the nucleus.


How does the tRNA sequence compare to the original DNA sequence?

The tRNA sequence is derived from the DNA sequence through a process called transcription. During transcription, the DNA sequence is first converted into messenger RNA (mRNA), which is then translated into tRNA. The tRNA sequence is complementary to the mRNA codons, with the exception that uracil (U) in tRNA replaces thymine (T) found in DNA. Therefore, the tRNA sequence reflects the genetic code specified by the DNA, but in a format suitable for protein synthesis.

Related Questions

An original DNA strand has the following base sequence ACGTAAGCT What base sequence would be produced through transcription?

During transcription, the DNA sequence ACGTAAGCT is translated into a complementary RNA sequence. The base pairing rules dictate that adenine (A) pairs with uracil (U) in RNA instead of thymine (T) found in DNA. Thus, the RNA sequence produced would be UGCAUUCGAA.


How is mRNA produced in a cell?

mRNA is produced through a process called transcription, which occurs in the nucleus of a cell. During transcription, the DNA sequence of a gene is copied into a complementary mRNA sequence by RNA polymerase enzyme. This mRNA transcript is then processed and modified before it is transported out of the nucleus to be translated into protein in the cytoplasm.


DNA passes information to RNA during what process?

Transcription. DNA serves as the template for the synthesis of RNA molecules through transcription. During transcription, the information encoded in the DNA is transcribed into a complementary RNA sequence by RNA polymerase.


Arrangement of nucleotides that determines the sequence of amino acids that will make up the protein?

The arrangement of nucleotides in DNA determines the sequence of amino acids in a protein through the process of transcription and translation. During transcription, RNA is synthesized from DNA, and during translation, the sequence of RNA nucleotides is decoded into a specific sequence of amino acids, forming a protein specified by the DNA sequence.


Where is rRNA produced in a cell?

Unmodified RNA is produced through transcription. Where transcription occurs depends on if the organism is a prokaryote (bacteria or archea) or eukaryote (plant or animal). RNA in prokaryotes is produced inside the cell membrane. RNA in eukaryotes is produced inside the nucleus.


Messenger rna is formed by the process of?

Messenger RNA (mRNA) is formed through a process called transcription. During transcription, the DNA sequence of a gene is copied into a complementary mRNA sequence by an enzyme called RNA polymerase. This mRNA molecule then carries the genetic information from the nucleus to the cytoplasm, where it serves as a template for protein synthesis.


How does the tRNA sequence compare to the original DNA sequence?

The tRNA sequence is derived from the DNA sequence through a process called transcription. During transcription, the DNA sequence is first converted into messenger RNA (mRNA), which is then translated into tRNA. The tRNA sequence is complementary to the mRNA codons, with the exception that uracil (U) in tRNA replaces thymine (T) found in DNA. Therefore, the tRNA sequence reflects the genetic code specified by the DNA, but in a format suitable for protein synthesis.


What is the mrna produced in a t t c g a c c t a c g?

The mRNA sequence produced from the DNA sequence "ATTCGACCTACG" would be "UAAGCUGGAUGC." This is achieved through the process of transcription, where RNA polymerase reads the DNA template and synthesizes a complementary mRNA strand.


What protein is produced when gene is activated through transcription and translation?

The protein coded for in the DNA transcribed ad then translated.


What happens right after the end of transcription?

After transcription, the mRNA produced is modified through processes like capping and polyadenylation. This modified mRNA then leaves the nucleus and enters the cytoplasm where it can be translated into a protein by ribosomes.


What is the relationship between a cognate protein and its corresponding gene in the process of protein synthesis?

A cognate protein is a protein that is produced by a gene with a matching sequence. In the process of protein synthesis, the gene serves as a template for the production of the cognate protein through transcription and translation. The gene provides the instructions for the sequence of amino acids that make up the protein, which is then synthesized by the cell.


The process of making an RNA version of a gene is?

The process of making an RNA version of a gene is called transcription. During transcription, the DNA sequence of a gene is used as a template to synthesize a complementary RNA molecule. This RNA molecule can then be used to produce proteins through the process of translation.