0
What else can I help you with?
Ifa DNA triplet is CTA then what is the complimentary DNA?
The complementary DNA sequence to CTA is GAT. In DNA, adenine (A) pairs with thymine (T) and cytosine (C) pairs with guanine (G). So, for every C in one strand, there should be a G in the complementary strand, and for every T in the original strand, there should be an A in the complementary strand.
What is the complementary sequence of bases in the strand of DNA AACCCTGAGTCT?
taacgggtac
What is the complementary strand for 3' cta tag gag act cat 5'?
The complementary strand for the sequence 3' cta tag gag act cat 5' is 5' gat atc tca tga gta 3'. This is determined by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G), while also reversing the direction of the strand.
What is GAT CCG after transcription?
After transcription, GAT CCG would be transcribed into its complementary RNA sequence, which is CUA GGC. The process involves converting DNA into RNA by replacing adenine with uracil, thymine with adenine, cytosine with guanine, and guanine with cytosine.
What are four examples of codons and what are the instructions they encode?
Codon is a group of three bases on a DNA molecule, each determining the identity of one amino acid in proteins made by a cell. An example of a codon is the mRNA sequence of AUG.
Ifa DNA triplet is CTA then what is the complimentary DNA?
The complementary DNA sequence to CTA is GAT. In DNA, adenine (A) pairs with thymine (T) and cytosine (C) pairs with guanine (G). So, for every C in one strand, there should be a G in the complementary strand, and for every T in the original strand, there should be an A in the complementary strand.
What is the complementary sequence of bases in the strand of DNA AACCCTGAGTCT?
taacgggtac
If a DNA stand sequence tagcaagc what will be the complimentary strand?
The complementary strand to tagcaagc would be ATCGTTCG. In DNA, adenine (A) pairs with thymine (T), while cytosine (C) pairs with guanine (G). So, the complementary bases are matched accordingly to form the opposite strand.
What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?
The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
Which strand of mrna would be made during transcription using the dna strand gat ccc?
Gcu aga
Consider a strand of DNA with this sequence AAA tga caa cta cca tct tga gca aca aga what is the corresponding sequence of the other side of the DNA helix how would you get the answer?
The corresponding strand is TTT act gtt gat ggt aga act cgt tgt tct. To find it, you need to identify the complementary base pairs: adenine (A) with thymine (T), cytosine (C) with guanine (G). Then, simply replace each base with its complementary one to obtain the other side of the DNA helix.
Aggctaacctg is the first strand what is the 2nd strand of DNA?
Tcc gat tgg ac
What is the complementary strand for 3' cta tag gag act cat 5'?
The complementary strand for the sequence 3' cta tag gag act cat 5' is 5' gat atc tca tga gta 3'. This is determined by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G), while also reversing the direction of the strand.
What is complementary to gatcgt during dna replication?
The complementary base to adenine (A) is thymine (T), and the complementary base to cytosine (C) is guanine (G). Therefore, during DNA replication, the complementary sequence to gatcgt would be ctagca.
What is GAT CCG after transcription?
After transcription, GAT CCG would be transcribed into its complementary RNA sequence, which is CUA GGC. The process involves converting DNA into RNA by replacing adenine with uracil, thymine with adenine, cytosine with guanine, and guanine with cytosine.
Which strand of mrna would be made during transcription using the dna strand gat ccg?
Ucg cga GAC UAU
