0
Consider a strand of DNA with this sequence AAA tga caa cta cca tct tga gca aca aga what is the corresponding sequence of the other side of the DNA helix how would you get the answer?
Wiki User
∙ 16y ago
tttactgttgatggtagaactcgttgttct
Wiki User
∙ 16y ago
Add your answer:
Earn +20 pts
If the base sequence on one DNA strand is ATGGCCTAG what is the sequence on the strand of the helix?
The sequence on the strand of the helix is TACCGGATC.
What does it mean to say DNA polymerase reads a template strand to make the complementary strand?
During DNA replication, the enzyme DNA polymerase catalyses the formation of new strands of DNA, using the old strands as models. DNA has a double-helix structure, with two strands forming each helix. Each strand is made up of DNA nucleotides, with the genetic information encoded in the sequence of different nucleotides (different nucleotides are distinguished by molecules called 'bases' attached to them, so the sequence of nucleotides is known as the 'base sequence'). The base sequence of one strand is complementary to that of its' neighbour - the base A binds with T, and C with G, so if one strand had the sequence ATTACA, the base sequence of the complementary strand would be TAATGT. When DNA polymerase creates a new DNA strand, it does so by matching nucleotides to the base sequence of one of the strands - the template strand. New nucleotides are brought in, which match the template in a complementary fashion (ie. A-T, C-G), and join to become one new strand. This new strand is complementary to the template.
Along one strand of a DNA double helix is the nucleotide sequence ggcataggt what is the sequence for the mRNA strand?
5`... ccagattg ... 3` 3`... ggtctaac ... 5`Remember always A complementarly binds with t with a double bond (hydrogens bonds)(a=t) in the same way g with c by means of 3hydrogen bonds between them.....
What is the relationship of the two DNA strands to each other?
The two strands in a DNA molecule (the polynucleotides) are complementary to each other. This means that the base sequence in one strand determines the base sequence in the other strand. This happens because of specific base pairing. An adenine in one strand always pairs with a thymine in the other strand, and a cytosine in one strand always pairs with a guanine in the other strand. So if you know the base sequence in one strand of the DNA yoiu can work out the sequence in the complementary strand. See: http://www.phschool.com/science/biology_place/biocoach/dnarep/basepair.htmlDNA strands run anti-parallel from one another, and have a double helix structure. The strands are held together by hydrogen bonds between base pairs that are weak individually, but collectively strong.
How many stands make up DNA double helix?
The DNA double helix contains two coiled biopolymer strands. The double helix was discovered by James Watson and Francis Crick.
If the base sequence on one DNA strand is ATGGCCTAG what is the sequence on the strand of the helix?
The sequence on the strand of the helix is TACCGGATC.
What is the base sequence along the complementary region of the other strand of the double helix if one is GAATGC?
CTTACG
Are the two Double Helix the same?
no both the double helices aren't the same. the sequences(bases) that are part of one of the helix is sequence complementary to the other strand of DNA.structurally they form the helical pattern, the sequence information is absolutely different.this itself determines the specificity,
What shape is a DNA strand?
A DNA strand is shaped like a 'double helix'.
What does it mean to say DNA polymerase reads a template strand to make the complementary strand?
During DNA replication, the enzyme DNA polymerase catalyses the formation of new strands of DNA, using the old strands as models. DNA has a double-helix structure, with two strands forming each helix. Each strand is made up of DNA nucleotides, with the genetic information encoded in the sequence of different nucleotides (different nucleotides are distinguished by molecules called 'bases' attached to them, so the sequence of nucleotides is known as the 'base sequence'). The base sequence of one strand is complementary to that of its' neighbour - the base A binds with T, and C with G, so if one strand had the sequence ATTACA, the base sequence of the complementary strand would be TAATGT. When DNA polymerase creates a new DNA strand, it does so by matching nucleotides to the base sequence of one of the strands - the template strand. New nucleotides are brought in, which match the template in a complementary fashion (ie. A-T, C-G), and join to become one new strand. This new strand is complementary to the template.
Along one strand of a DNA double helix is the nucleotide sequence ggcataggt what is the sequence for the mRNA strand?
5`... ccagattg ... 3` 3`... ggtctaac ... 5`Remember always A complementarly binds with t with a double bond (hydrogens bonds)(a=t) in the same way g with c by means of 3hydrogen bonds between them.....
Which part of DNA is double helix?
The whole DNA strand is a double helix.
What molecule has the shape of a double strand helix?
DNA, and the shape is also known as a double helix.
How do you find a complimentry strand of DNA?
DNA usually comes in a double stranded helix, but if there is only one strand provided, complimentary base pairing occurs. Adenine and Thymine pair, as do Guanine and Cytosine. Given a sequence of DNA, using this, you can find its complementary strand.
What type of strand does DNA have?
A double helix
What shape does the DNA strand have?
A double helix.
What is complementary sequence?
When DNA and/or RNA are in the double helix configuration each helix is the complementary sequence of the other.
