tttactgttgatggtagaactcgttgttct
The sequence on the strand of the helix is TACCGGATC.
A DNA double helix is made up of two stands that twist around each other in a spiral shape. Each strand consists of a sequence of nucleotide bases that pair up with the bases on the opposite strand, forming the characteristic double helix structure.
you have to give the DNA sequence formula for ex: TCGAACT the other half must be AGCTTGA
5`... ccagattg ... 3` 3`... ggtctaac ... 5`Remember always A complementarly binds with t with a double bond (hydrogens bonds)(a=t) in the same way g with c by means of 3hydrogen bonds between them.....
During DNA replication, the enzyme DNA polymerase catalyses the formation of new strands of DNA, using the old strands as models. DNA has a double-helix structure, with two strands forming each helix. Each strand is made up of DNA nucleotides, with the genetic information encoded in the sequence of different nucleotides (different nucleotides are distinguished by molecules called 'bases' attached to them, so the sequence of nucleotides is known as the 'base sequence'). The base sequence of one strand is complementary to that of its' neighbour - the base A binds with T, and C with G, so if one strand had the sequence ATTACA, the base sequence of the complementary strand would be TAATGT. When DNA polymerase creates a new DNA strand, it does so by matching nucleotides to the base sequence of one of the strands - the template strand. New nucleotides are brought in, which match the template in a complementary fashion (ie. A-T, C-G), and join to become one new strand. This new strand is complementary to the template.
The sequence on the strand of the helix is TACCGGATC.
In DNA, the other strand of the helix would have complementary base pairs to the original strand. Adenine pairs with thymine, and cytosine pairs with guanine. So, if one strand has the sequence ATTGC, the complementary strand would be TAACG.
The complementary sequence to GAATGC is CTTACG. In DNA, adenine pairs with thymine, so if one strand has a guanine (G), the complementary strand will have a cytosine (C); and if one strand has an adenine (A), the complementary strand will have a thymine (T).
lol i hate this question........its in meh science book
A DNA double helix is made up of two stands that twist around each other in a spiral shape. Each strand consists of a sequence of nucleotide bases that pair up with the bases on the opposite strand, forming the characteristic double helix structure.
you have to give the DNA sequence formula for ex: TCGAACT the other half must be AGCTTGA
No, DNA is a double-stranded molecule composed of nucleotides. Each strand has a specific sequence of four different nucleotides: adenine, thymine, cytosine, and guanine. These two strands are connected by hydrogen bonds to form the double helix structure of DNA.
no both the double helices aren't the same. the sequences(bases) that are part of one of the helix is sequence complementary to the other strand of DNA.structurally they form the helical pattern, the sequence information is absolutely different.this itself determines the specificity,
The whole DNA strand is a double helix.
5`... ccagattg ... 3` 3`... ggtctaac ... 5`Remember always A complementarly binds with t with a double bond (hydrogens bonds)(a=t) in the same way g with c by means of 3hydrogen bonds between them.....
A double helix.
A double helix