0
Along one strand of a DNA double helix is the nucleotide sequence ggcataggt what is the sequence for the mRNA strand?
5`... ccagattg ... 3` 3`... ggtctaac ... 5`
Remember always A complementarly binds with t with a double bond (hydrogens bonds)(a=t) in the same way g with c by means of 3hydrogen bonds between them.....
What else can I help you with?
If one strand of DNA has a nucleotide base sequence of tcaggtccat?
If one strand of DNA has a nucleotide base sequence of tcaggtccat, its complementary strand is agtccaggta. Adenine pairs with thymine, while guanine pairs with cytosine.
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What is the structure of Double stranded DNA molecule in palindromic sequence?
A palindromic DNA sequence is one where the nucleotide sequence reads the same forwards and backwards on both strands. In the double-stranded DNA molecule, the two strands are complementary and run anti-parallel to each other. This means that the palindromic sequence on one strand will have its complementary sequence on the other strand.
A nucleotide is about to be added to a growing strand of DNA. What factor determines which type of nucleotide will be added?
The sequence of nucleotides in the template DNA strand determines which complementary nucleotide will be added to the growing strand. A-T and G-C base pairing rules govern the selection of the nucleotide to be added during DNA replication.
The DNA language consists of a linear sequence of nucleotide?
Yes, the DNA language is composed of four nucleotide bases: adenine, cytosine, guanine, and thymine, arranged in a linear sequence along the DNA strand. This sequence carries genetic information that is transcribed and translated to produce proteins.
If one strand of DNA has a nucleotide base sequence of tcaggtccat?
If one strand of DNA has a nucleotide base sequence of tcaggtccat, its complementary strand is agtccaggta. Adenine pairs with thymine, while guanine pairs with cytosine.
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What is the structure of Double stranded DNA molecule in palindromic sequence?
A palindromic DNA sequence is one where the nucleotide sequence reads the same forwards and backwards on both strands. In the double-stranded DNA molecule, the two strands are complementary and run anti-parallel to each other. This means that the palindromic sequence on one strand will have its complementary sequence on the other strand.
What is the other strand of double sequence GTCCAT?
CAGGTA
If you had a small single strand of DNA with the nucleotide sequence cagtact what would the sequence be for the other DNA strand?
The complementary DNA strand would be GTACTGA. In DNA, adenine pairs with thymine and cytosine pairs with guanine.
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
What determines the nucleotide sequence of the newly synthesised strand during DNA replication?
The nucleotide sequence of the newly synthesized strand during DNA replication is determined by complementary base pairing. Adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). The existing DNA strand serves as a template for the formation of the complementary strand.
What nucleotide sequence would be found on the partner DNA strand of the strand shown ACTGT?
The complementary (partner) strand to the segment ACTGT would be TGACA. This is because in DNA, A binds to T and C binds to G.
A nucleotide is about to be added to a growing strand of DNA. What factor determines which type of nucleotide will be added?
The sequence of nucleotides in the template DNA strand determines which complementary nucleotide will be added to the growing strand. A-T and G-C base pairing rules govern the selection of the nucleotide to be added during DNA replication.
The DNA language consists of a linear sequence of nucleotide?
Yes, the DNA language is composed of four nucleotide bases: adenine, cytosine, guanine, and thymine, arranged in a linear sequence along the DNA strand. This sequence carries genetic information that is transcribed and translated to produce proteins.
How would the bases of the complementary strand read?
The complementary sequence of a DNA strand is written with the beginning letters of the bases: adenine (A), cytosine (C), guanine (G), and thymine (T). You would replace each letter with its complementary nucleotide. Replace: A for T T for A C for G G for C
Draw an mrna strand that is complementary to the dna strand aattgc?
DNA Strand: AATTGC mRNA Strand: UUAACG I don't know what the circle a nucleotide part means
