0
Draw an mrna strand that is complementary to the dna strand aattgc?
Wiki User
∙ 12y ago
DNA Strand: AATTGC
mRNA Strand: UUAACG
I don't know what the circle a nucleotide part means
Wiki User
∙ 13y ago
Add your answer:
Earn +20 pts
Is thera a Drawing of a mRNA srand that is complementary to the DNA strand aattgc?
No.
What is the complementary mrna strand for cca?
it is ggu
What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?
The strand is called the parental strand. the gene being copied would depend on which protein is needed.
What strand of mRNA would be produced from the strand of DNA shown below?
The DNA strand CAT-TAG would produce a complementary mRNA strand of GUA-AUC.
A segment of DNA has the following sequence ttaaggcc which sequence of bases would be found on the complementary strand of mrna?
TGCA
Is thera a Drawing of a mRNA srand that is complementary to the DNA strand aattgc?
No.
What is the complementary mrna strand for cca?
it is ggu
What strand of DNA is use to make a complementary copy or to make a complementary mRNA molecule?
The template strand is used to make a complementary copy. This is a type of DNA strand.
What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?
The strand is called the parental strand. the gene being copied would depend on which protein is needed.
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
What strand of mRNA would be produced from the strand of DNA shown below?
The DNA strand CAT-TAG would produce a complementary mRNA strand of GUA-AUC.
A segment of DNA has the following sequence ttaaggcc which sequence of bases would be found on the complementary strand of mrna?
TGCA
Complementary to an mRNA codon?
it depends on the codon spcified. The tRNA will have the complementary strand along with an amino acid, for which is specified by the mRNA. if the mRNA codon was "CGA" the tRNA codon would have an amino acid and the complementary codon of "GCU"
How do you know what to write for each of the new mrna codes?
mRNA is the complementary of the DNA strand that it attatches to, and replace T with G
Is transcription the manufacture of a strand of RNA complementary to a strand of DNA?
Yes. The strand of RNA is messenger RNA, mRNA.
What would the DNA sequence have been for the following mrna strand cuc-aag-ugc-uuc?
mRNA forms a complementary sequence to the DNA it is transcribed from. Therefore, the DNA strand would be the complement (opposite base pair) from what is present in the mRNA. Also, remember that RNA uses uracil (U) in place of thymine (T). For the mRNA strand CUC-AAG-UGC-UUC, the complementary DNA strand would be GAG-TTC-ACG-AAG.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
