answersLogoWhite

0

mRNA is complementary to the template strand of DNA during transcription. The template strand serves as a template for mRNA synthesis, directing the formation of a complementary mRNA transcript.

User Avatar

AnswerBot

1y ago

What else can I help you with?

Continue Learning about Biology

Is transcription the manufacture of a strand of RNA complementary to a strand of DNA?

Yes, that's correct. Transcription is the process by which the genetic information in a segment of DNA is used to create a complementary RNA strand. This RNA molecule can then be used to direct the synthesis of proteins in a cell.


What strand of DNA does RNA polymerase use during transcription?

During transcription, RNA polymerase uses the template strand of DNA to create a complementary RNA strand.


3 What is the name of the process in which DNA is copied into a form of RNA?

The process is called transcription. During transcription, the enzyme RNA polymerase converts DNA into messenger RNA (mRNA) by reading the DNA template and synthesizing a complementary RNA strand.


What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?

During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC


How does DNA template dictate the sequence of the RNA produced?

During transcription the DNA double helix is separated into two individual strands. Each strand may serve as a template for RNA polymerase, which travels along the DNA structure in a 3' to 5' direction. As it progresses down the strand, RNA polymerase synthesizes a pre-messenger RNA strand that is complementary to the sequence on the DNA template. For example if the DNA sequence on the template was 5' ATACA 3', then the pre mRNA sequence synthesized would be 3' UAUGU 5'. (Remember, RNA synthesis utilizes the nucleotide uracil instead of thyamine).

Related Questions

Is transcription the manufacture of a strand of RNA complementary to a strand of DNA?

Yes, that's correct. Transcription is the process by which the genetic information in a segment of DNA is used to create a complementary RNA strand. This RNA molecule can then be used to direct the synthesis of proteins in a cell.


What are long strands of rna that are complementary to one strand of DNA?

Long strands of RNA that are complementary to one strand of DNA are called messenger RNA (mRNA). During the process of transcription, RNA polymerase synthesizes mRNA by using one strand of DNA as a template, creating a complementary RNA sequence. This mRNA then carries the genetic information from the DNA in the nucleus to the ribosomes, where it is translated into proteins.


What is a molecule of Rna complementary to the coding strand DNA in the gene?

A molecule of RNA complementary to the coding strand DNA in a gene is called messenger RNA (mRNA). mRNA is transcribed from the DNA template strand and carries the genetic information from the DNA to the ribosome for protein synthesis. It is made up of nucleotides that are complementary to those on the coding strand of DNA.


Which strand of dan molecule a or b was used to produce the messenger rna?

In the process of transcription, the template strand of DNA (often referred to as the antisense or non-coding strand) is used to produce messenger RNA (mRNA). This strand serves as the guide for RNA polymerase to synthesize the mRNA complementary to it. The other strand, known as the coding or sense strand, has a sequence that matches the mRNA (with uracil replacing thymine). Therefore, if strand A is the template, then mRNA is produced based on strand A.


The manufacture of a strand of RNA complementary to a strand of DNA is termed?

Transcription


What RNA strand is produced from DNA?

messenger RNA (mRNA)


What enzyme does transcription require?

Transcription requires the enzyme RNA polymerase. This enzyme synthesizes RNA by reading the DNA template strand and adding complementary RNA nucleotides, facilitating the formation of an RNA strand. In eukaryotes, multiple types of RNA polymerase exist, with RNA polymerase II being responsible for synthesizing messenger RNA (mRNA).


What is copied during transcription?

During transcription, a segment of DNA is copied into messenger RNA (mRNA). The enzyme RNA polymerase binds to the DNA template strand and synthesizes a complementary RNA strand by adding RNA nucleotides that are complementary to the DNA bases. This process occurs in the nucleus of eukaryotic cells and results in the formation of an mRNA molecule that carries the genetic information needed for protein synthesis.


What strand of DNA does RNA polymerase use during transcription?

During transcription, RNA polymerase uses the template strand of DNA to create a complementary RNA strand.


What would be the mrna base sequence formed during transcription using the DNA sequence below?

Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.


3 What is the name of the process in which DNA is copied into a form of RNA?

The process is called transcription. During transcription, the enzyme RNA polymerase converts DNA into messenger RNA (mRNA) by reading the DNA template and synthesizing a complementary RNA strand.


What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?

During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC