0
What else can I help you with?
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
A nucleotide is about to be added to a growing strand of DNA. What factor determines which type of nucleotide will be added?
The sequence of nucleotides in the template DNA strand determines which complementary nucleotide will be added to the growing strand. A-T and G-C base pairing rules govern the selection of the nucleotide to be added during DNA replication.
The nucleotide base sequence of a strand of DNA is TAC-CGG-AGT. What is the sequence of the complementary DNA strand?
The complementary DNA strand to TAC-CGG-AGT is ATG-GCC-TCA. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G), so the complementary strand is created by matching these base pairs.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
A fragment of a strand of nucleic acid isolated from a silk moth species contains the base sequence CAGACT The strand must be from?
The base sequence CAGACT corresponds to the DNA strand, and it would be complementary to the RNA strand with the sequence GUCUGA. Therefore, the original strand is the DNA strand.
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
A nucleotide is about to be added to a growing strand of DNA. What factor determines which type of nucleotide will be added?
The sequence of nucleotides in the template DNA strand determines which complementary nucleotide will be added to the growing strand. A-T and G-C base pairing rules govern the selection of the nucleotide to be added during DNA replication.
The nucleotide base sequence of a strand of DNA is TAC-CGG-AGT. What is the sequence of the complementary DNA strand?
The complementary DNA strand to TAC-CGG-AGT is ATG-GCC-TCA. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G), so the complementary strand is created by matching these base pairs.
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
What determines the nucleotide sequence of the newly synthesised strand during DNA replication?
The nucleotide sequence of the newly synthesized strand during DNA replication is determined by complementary base pairing. Adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). The existing DNA strand serves as a template for the formation of the complementary strand.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
A fragment of a strand of nucleic acid isolated from a silk moth species contains the base sequence CAGACT The strand must be from?
The base sequence CAGACT corresponds to the DNA strand, and it would be complementary to the RNA strand with the sequence GUCUGA. Therefore, the original strand is the DNA strand.
What is the sequence of the base os agctcag on the opposite strand?
A TG CAGATTCTCTAAG
Why can you predict the base sequence of one strand in a molecule of DNA if you know the sequence of the others strand?
in DNA, each base pairs up with only one other base
What is a change in the base sequence in DNA?
A change in the nucleotide sequence of DNA is called a mutation.
What is the change of the base sequence of DNA?
A change in the nucleotide sequence of DNA is called a mutation.
What is the complementary base sequence of DNA strand?
TGCA
