If one strand of DNA has a nucleotide base sequence of tcaggtccat, its complementary strand is agtccaggta. Adenine pairs with thymine, while guanine pairs with cytosine.
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
The sequence of nucleotides in the template DNA strand determines which complementary nucleotide will be added to the growing strand. A-T and G-C base pairing rules govern the selection of the nucleotide to be added during DNA replication.
The complementary DNA strand to TAC-CGG-AGT is ATG-GCC-TCA. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G), so the complementary strand is created by matching these base pairs.
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
The base sequence CAGACT corresponds to the DNA strand, and it would be complementary to the RNA strand with the sequence GUCUGA. Therefore, the original strand is the DNA strand.
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
The sequence of nucleotides in the template DNA strand determines which complementary nucleotide will be added to the growing strand. A-T and G-C base pairing rules govern the selection of the nucleotide to be added during DNA replication.
The complementary DNA strand to TAC-CGG-AGT is ATG-GCC-TCA. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G), so the complementary strand is created by matching these base pairs.
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
The nucleotide sequence of the newly synthesized strand during DNA replication is determined by complementary base pairing. Adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). The existing DNA strand serves as a template for the formation of the complementary strand.
The complementary strand for the DNA sequence ccgatacgcggtatcccagggctaattuaa is ggctatgcgccatatgggtaatgtaagg. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each nucleotide in the original strand is matched with its complementary base to form the new strand.
To determine the base sequence of strand II, you need to know the complementary base pairing rules of DNA, where adenine (A) pairs with thymine (T) and cytosine (C) pairs with guanine (G). If you have the sequence of strand I, you can derive strand II by replacing each base with its complement. For example, if strand I is "ATCG," then strand II would be "TAGC." Please provide the specific sequence of strand I for a precise answer.
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
The base sequence CAGACT corresponds to the DNA strand, and it would be complementary to the RNA strand with the sequence GUCUGA. Therefore, the original strand is the DNA strand.
A TG CAGATTCTCTAAG
You can predict the base sequence of one strand of DNA if you know the sequence of the other strand because DNA strands are complementary. Adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). This complementary base pairing allows the sequence of one strand to dictate the sequence of the other, enabling accurate predictions of the base sequence.
If you know the sequence of one strand of a DNA molecule, you can predict the base sequence of the complementary strand based on base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the known strand has the sequence 5'-ATCG-3', the complementary strand would have the sequence 3'-TAGC-5'. This complementary relationship allows for the accurate prediction of one strand's sequence from the other.