0
What else can I help you with?
What is the nucleotide sequence of the mRNA strand you built?
The nucleotide sequence of the mRNA strand is determined by the template DNA strand during transcription. It is complementary to the DNA template and consists of adenine (A), uracil (U), cytosine (C), and guanine (G). For example, if the DNA template strand is 3'-ATCGTACG-5', the corresponding mRNA sequence would be 5'-UAGCAUGC-3'.
What determines the nucleotide sequence of the newly synthesised strand during DNA replication?
The nucleotide sequence of the newly synthesized strand during DNA replication is determined by complementary base pairing. Adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). The existing DNA strand serves as a template for the formation of the complementary strand.
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
What nucleotide sequence would be found on the partner DNA strand of the strand shown ACTGT?
The complementary (partner) strand to the segment ACTGT would be TGACA. This is because in DNA, A binds to T and C binds to G.
What are the three types of mutation?
The three types of mutations are substitution (a single nucleotide is replaced with a different one), insertion (an extra nucleotide is added to the DNA sequence), and deletion (a nucleotide is removed from the DNA sequence).
If one strand of DNA has a nucleotide base sequence of tcaggtccat?
If one strand of DNA has a nucleotide base sequence of tcaggtccat, its complementary strand is agtccaggta. Adenine pairs with thymine, while guanine pairs with cytosine.
In the process of making a protein the purpose of an adaptor is to a copy the sequence of nucletides into a single strand of RNA B?
recognize a particular three-nucleotide codon
What is the nucleotide sequence of the mRNA strand you built?
The nucleotide sequence of the mRNA strand is determined by the template DNA strand during transcription. It is complementary to the DNA template and consists of adenine (A), uracil (U), cytosine (C), and guanine (G). For example, if the DNA template strand is 3'-ATCGTACG-5', the corresponding mRNA sequence would be 5'-UAGCAUGC-3'.
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
The direction of synthesis of an RNA transcript is?
transcription:"the first step in protein synthesis, a sequence of nucleotide bases becomes exposed in an unwound region of a DNA strand. That sequence acts as a template upon which a single strand of RNA - a transcript - is synthesized from free nucleotides."The synthesis of an RNA molecule from the DNA template strand is called transcription.
What determines the nucleotide sequence of the newly synthesised strand during DNA replication?
The nucleotide sequence of the newly synthesized strand during DNA replication is determined by complementary base pairing. Adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). The existing DNA strand serves as a template for the formation of the complementary strand.
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
What nucleotide sequence would be found on the partner DNA strand of the strand shown ACTGT?
The complementary (partner) strand to the segment ACTGT would be TGACA. This is because in DNA, A binds to T and C binds to G.
A nucleotide is about to be added to a growing strand of DNA. What factor determines which type of nucleotide will be added?
The sequence of nucleotides in the template DNA strand determines which complementary nucleotide will be added to the growing strand. A-T and G-C base pairing rules govern the selection of the nucleotide to be added during DNA replication.
What are the three types of mutation?
The three types of mutations are substitution (a single nucleotide is replaced with a different one), insertion (an extra nucleotide is added to the DNA sequence), and deletion (a nucleotide is removed from the DNA sequence).
Dna's nucleotide sequence is converted to the form of a single-stranded RNA molecule in a process called what?
Transcription is the process where a single-stranded RNA molecule is synthesized from the template DNA strand. It occurs in the cell nucleus and is catalyzed by the enzyme RNA polymerase.
Inverted repeat sequence in a single strand DNA?
cruciform dna
