lol i hate this question........its in meh science book
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
DNA usually comes in a double stranded helix, but if there is only one strand provided, complimentary base pairing occurs. Adenine and Thymine pair, as do Guanine and Cytosine. Given a sequence of DNA, using this, you can find its complementary strand.
The genetic code on the complementary strand refers to the sequence of nucleotides that pairs with a corresponding sequence on the original DNA strand. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, if the original strand has a sequence like ACGT, the complementary strand would have the sequence TGCA. This complementary base pairing is crucial for DNA replication and transcription processes.
DNA is made up four nucleotide bases,a pentose sugar and a phosphate. The four nucleotides are adenine, guanine, cytosine and thymine. Due to the nature of these molecules they fall into two groups called purines ( adenine an guanine) and pyrimidines ( cytosine and thymine). The bases have complimentary base pairing causing the double helix shape of DNA. adenine always bonds with thymjine and guanine with cytosine. So you can predict what the base sequence of one strand the other strand will be the opposite base pairing, for example if you know that a strand is AGAACTG the complimentary strand is TCTTGAC.
You can predict the base sequence of one strand of DNA if you know the sequence of the other strand because DNA strands are complementary. Adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). This complementary base pairing allows the sequence of one strand to dictate the sequence of the other, enabling accurate predictions of the base sequence.
lol i hate this question........its in meh science book
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
DNA usually comes in a double stranded helix, but if there is only one strand provided, complimentary base pairing occurs. Adenine and Thymine pair, as do Guanine and Cytosine. Given a sequence of DNA, using this, you can find its complementary strand.
DNA is made up four nucleotide bases,a pentose sugar and a phosphate. The four nucleotides are adenine, guanine, cytosine and thymine. Due to the nature of these molecules they fall into two groups called purines ( adenine an guanine) and pyrimidines ( cytosine and thymine). The bases have complimentary base pairing causing the double helix shape of DNA. adenine always bonds with thymjine and guanine with cytosine. So you can predict what the base sequence of one strand the other strand will be the opposite base pairing, for example if you know that a strand is AGAACTG the complimentary strand is TCTTGAC.
The base sequence CAGACT corresponds to the DNA strand, and it would be complementary to the RNA strand with the sequence GUCUGA. Therefore, the original strand is the DNA strand.
A TG CAGATTCTCTAAG
in DNA, each base pairs up with only one other base
TGCA
The sequence on the strand of the helix is TACCGGATC.
ATAGCC is complementary to the base sequence TATCGG.