taacgggtac
The complementary DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). Therefore, if one strand has the sequence gta-gca, the complementary strand would have the sequence cat-cgt.
To determine the sequence of the template strand, you need to find the complementary bases to the nontemplate strand (5' ATGGGCGC 3'). The complementary bases are A-T and G-C. Therefore, the sequence of the template strand will be 3' TACCCGCG 5', written in the opposite direction to maintain the 5' to 3' orientation.
To indicate the sequence of the template strand based on the nontemplate strand (5' ATGGGGCGC 3'), you need to determine the complementary bases and reverse the direction. The complementary bases are: T for A, C for G, and G for C. Therefore, the template strand sequence will be 3' TACCCCGCG 5'.
The complementary sequence of a DNA strand is written with the beginning letters of the bases: adenine (A), cytosine (C), guanine (G), and thymine (T). You would replace each letter with its complementary nucleotide. Replace: A for T T for A C for G G for C
To determine the base sequence on the complementary DNA strand, you need to know the base sequence of one strand. DNA is composed of four bases: adenine (A), thymine (T), cytosine (C), and guanine (G). The complementary base pairing rules state that A pairs with T and C pairs with G. For example, if the given strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'.
The complementary DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). Therefore, if one strand has the sequence gta-gca, the complementary strand would have the sequence cat-cgt.
To determine the sequence of the template strand, you need to find the complementary bases to the nontemplate strand (5' ATGGGCGC 3'). The complementary bases are A-T and G-C. Therefore, the sequence of the template strand will be 3' TACCCGCG 5', written in the opposite direction to maintain the 5' to 3' orientation.
To indicate the sequence of the template strand based on the nontemplate strand (5' ATGGGGCGC 3'), you need to determine the complementary bases and reverse the direction. The complementary bases are: T for A, C for G, and G for C. Therefore, the template strand sequence will be 3' TACCCCGCG 5'.
The complimentary strand of MRNA would be AAUUCCGG.
The order of bases in the second strand of a DNA molecule is complementary to the first strand, following the base pairing rules (A with T, C with G). So, if the first strand has the sequence ATCG, the second strand would have the sequence TAGC.
The complementary sequence of a DNA strand is written with the beginning letters of the bases: adenine (A), cytosine (C), guanine (G), and thymine (T). You would replace each letter with its complementary nucleotide. Replace: A for T T for A C for G G for C
TGCA
To determine the base sequence on the complementary DNA strand, you need to know the base sequence of one strand. DNA is composed of four bases: adenine (A), thymine (T), cytosine (C), and guanine (G). The complementary base pairing rules state that A pairs with T and C pairs with G. For example, if the given strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'.
To determine the complementary DNA base sequence for a given strand, you need to know the base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). If you provide the specific sequence of the partial DNA strand, I can help you identify the complementary bases that would pair with it.
lol i hate this question........its in meh science book
The complementary base pairing rule for DNA and mRNA is: A pairs with U, T pairs with A, G pairs with C, and C pairs with G. Therefore, the mRNA complementary strand for the DNA sequence TTAAGGCC would be AAUUCCGG.
To determine the DNA replication strand for the sequence ATGCATTGACGGTACCGATACATCAT, you need to find the complementary bases. The complementary strand would be TACGTAACCTGCCATGGCTATGTAGTA, where adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G).