answersLogoWhite

0

taacgggtac

User Avatar

Celia Lemke

Lvl 10
4y ago

What else can I help you with?

Continue Learning about Natural Sciences

If the sequence of nitrogenous bases is one standard of DNA is gta-gca the sequence of bases on its complementary DNA stand would be?

The complementary DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). Therefore, if one strand has the sequence gta-gca, the complementary strand would have the sequence cat-cgt.


What is the sequence of the template strand if a nontenplate strand has the sequence 5'ATGGGCGC3'?

To determine the sequence of the template strand, you need to find the complementary bases to the nontemplate strand (5' ATGGGCGC 3'). The complementary bases are A-T and G-C. Therefore, the sequence of the template strand will be 3' TACCCGCG 5', written in the opposite direction to maintain the 5' to 3' orientation.


How do you indicate the secuence of the templates strand if a nontemplate strand has the sequence 5' ATGGGGCGC 3'?

To indicate the sequence of the template strand based on the nontemplate strand (5' ATGGGGCGC 3'), you need to determine the complementary bases and reverse the direction. The complementary bases are: T for A, C for G, and G for C. Therefore, the template strand sequence will be 3' TACCCCGCG 5'.


How would the bases of the complementary strand read?

The complementary sequence of a DNA strand is written with the beginning letters of the bases: adenine (A), cytosine (C), guanine (G), and thymine (T). You would replace each letter with its complementary nucleotide. Replace: A for T T for A C for G G for C


What is the base sequence on the other strand?

To determine the base sequence on the complementary DNA strand, you need to know the base sequence of one strand. DNA is composed of four bases: adenine (A), thymine (T), cytosine (C), and guanine (G). The complementary base pairing rules state that A pairs with T and C pairs with G. For example, if the given strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'.

Related Questions

If the sequence of nitrogenous bases is one standard of DNA is gta-gca the sequence of bases on its complementary DNA stand would be?

The complementary DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). Therefore, if one strand has the sequence gta-gca, the complementary strand would have the sequence cat-cgt.


What is the sequence of the template strand if a nontenplate strand has the sequence 5'ATGGGCGC3'?

To determine the sequence of the template strand, you need to find the complementary bases to the nontemplate strand (5' ATGGGCGC 3'). The complementary bases are A-T and G-C. Therefore, the sequence of the template strand will be 3' TACCCGCG 5', written in the opposite direction to maintain the 5' to 3' orientation.


How do you indicate the secuence of the templates strand if a nontemplate strand has the sequence 5' ATGGGGCGC 3'?

To indicate the sequence of the template strand based on the nontemplate strand (5' ATGGGGCGC 3'), you need to determine the complementary bases and reverse the direction. The complementary bases are: T for A, C for G, and G for C. Therefore, the template strand sequence will be 3' TACCCCGCG 5'.


A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?

The complimentary strand of MRNA would be AAUUCCGG.


What is the order of bases in the second strand of the DNA molecule?

The order of bases in the second strand of a DNA molecule is complementary to the first strand, following the base pairing rules (A with T, C with G). So, if the first strand has the sequence ATCG, the second strand would have the sequence TAGC.


How would the bases of the complementary strand read?

The complementary sequence of a DNA strand is written with the beginning letters of the bases: adenine (A), cytosine (C), guanine (G), and thymine (T). You would replace each letter with its complementary nucleotide. Replace: A for T T for A C for G G for C


What would be the base sequence of the complementary mRNA strand?

TGCA


What is the base sequence on the other strand?

To determine the base sequence on the complementary DNA strand, you need to know the base sequence of one strand. DNA is composed of four bases: adenine (A), thymine (T), cytosine (C), and guanine (G). The complementary base pairing rules state that A pairs with T and C pairs with G. For example, if the given strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'.


Which sequence of DNA bases would pair with the one shown in the partial strand below?

To determine the complementary DNA base sequence for a given strand, you need to know the base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). If you provide the specific sequence of the partial DNA strand, I can help you identify the complementary bases that would pair with it.


What be would the complementary strand of DNA for the following sequence of bases?

lol i hate this question........its in meh science book


What is the A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?

The complementary base pairing rule for DNA and mRNA is: A pairs with U, T pairs with A, G pairs with C, and C pairs with G. Therefore, the mRNA complementary strand for the DNA sequence TTAAGGCC would be AAUUCCGG.


What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT?

To determine the DNA replication strand for the sequence ATGCATTGACGGTACCGATACATCAT, you need to find the complementary bases. The complementary strand would be TACGTAACCTGCCATGGCTATGTAGTA, where adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G).