answersLogoWhite

0

A matching strand of DNA to the sequence AGTAAC would be its complementary strand, which consists of the bases that pair with each nucleotide. In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). Therefore, the complementary strand to AGTAAC would be TCATTG.

User Avatar

AnswerBot

12mo ago

What else can I help you with?

Continue Learning about Natural Sciences

What stand of DNA has the same bases agtaac?

The DNA strand that has the same bases as "AGTAAC" would be its complementary strand, which is "TCATTG." In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C), so each base on one strand is matched by its complementary base on the opposite strand.


What is the matching DNA strand called?

The matching DNA strand is called the complementary strand. In DNA, the bases pair specifically: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). This complementary base pairing is essential for the structure of DNA and plays a crucial role in processes like DNA replication and transcription.


Why the DNA molecule is compared with a twisted ladder?

the whole DNA strand looks like a twisted ladder. the molecules are on the strand.


What enzyme is responsible for decodingthe DNA strand into an mRNA?

The enzyme responsible for decoding the DNA strand into an mRNA is called RNA polymerase. It catalyzes the synthesis of mRNA during transcription by matching complementary RNA nucleotides with the DNA template strand.


What is the function of one strand in the double helix structure during DNA replication?

During DNA replication, one strand of the double helix serves as the template for synthesizing a new complementary strand. The enzyme DNA polymerase reads the template strand and adds nucleotides one by one, matching them with the appropriate bases (adenine with thymine, and cytosine with guanine). This process ensures that the genetic information is accurately copied and passed on to the daughter cells. The other strand, known as the lagging strand, is synthesized in short segments, which are later joined together.

Related Questions

What stand of DNA has the same bases agtaac?

The DNA strand that has the same bases as "AGTAAC" would be its complementary strand, which is "TCATTG." In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C), so each base on one strand is matched by its complementary base on the opposite strand.


What is the 2nd stand matching DNA?

The 2nd strand matching DNA refers to the strand that can pair with the original DNA sequence through complementary base pairing. In DNA replication, this matching strand is synthesized by DNA polymerase according to the sequence on the original template strand.


During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?

gaucgaucacucaggacuaug


A strand of DNA contains the base sequence AGTT. What is the sequence of the complementary strand of DNA?

The complementary strand of DNA for the sequence AGTT would be TCAA. In DNA, adenine pairs with thymine and guanine pairs with cytosine. So the complementary base for A is T, G is C, T is A, and T is A.


What is the matching DNA strand called?

The matching DNA strand is called the complementary strand. In DNA, the bases pair specifically: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). This complementary base pairing is essential for the structure of DNA and plays a crucial role in processes like DNA replication and transcription.


What bases would match up to form a matching DNA strand from this pattern?

A pairs with T, C pairs with G. So the matching bases for a DNA strand with the pattern GATC would be CTAG.


Why the DNA molecule is compared with a twisted ladder?

the whole DNA strand looks like a twisted ladder. the molecules are on the strand.


The nucleotide base sequence of a strand of DNA is TAC-CGG-AGT. What is the sequence of the complementary DNA strand?

The complementary DNA strand to TAC-CGG-AGT is ATG-GCC-TCA. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G), so the complementary strand is created by matching these base pairs.


What enzyme is responsible for decodingthe DNA strand into an mRNA?

The enzyme responsible for decoding the DNA strand into an mRNA is called RNA polymerase. It catalyzes the synthesis of mRNA during transcription by matching complementary RNA nucleotides with the DNA template strand.


How does base pairing contribute to the accuracy of DNA replication?

Base pairing in DNA replication ensures that the correct nucleotides are added to the new DNA strand, matching with their complementary bases. This contributes to the accuracy of DNA replication by reducing the chances of errors or mutations in the newly synthesized DNA strand.


How does the process of DNA replication occur, considering the fact that DNA polymerase can only add nucleotides?

During DNA replication, the enzyme DNA polymerase adds nucleotides to the growing DNA strand by matching them with the complementary nucleotides on the template strand. This process ensures accurate copying of the genetic information.


IMPORTANT After DNA replication does half of the old strand leave with half of the new strand?

The process of DNA replication is described as being semi-conservative. The complementary DNA strands are pulled apart, new matching nucleotides are connected to each separate strand, and the result is two new strands that each contain exactly one-half of the original DNA strand.