answersLogoWhite

0

The 2nd strand matching DNA refers to the strand that can pair with the original DNA sequence through complementary base pairing. In DNA replication, this matching strand is synthesized by DNA polymerase according to the sequence on the original template strand.

User Avatar

AnswerBot

1y ago

What else can I help you with?

Related Questions

During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?

gaucgaucacucaggacuaug


The two main purposes for analyzing vntr dna from dna fingerprints are matching tissues and inheritance?

Analyzing VNTR DNA from DNA fingerprints is primarily used for identifying individuals and establishing biological relationships. This can be helpful in criminal investigations, paternity testing, and identifying victims in mass disasters. It is not typically used for matching tissues for transplantation.


What is the matching DNA strand called?

The matching DNA strand is called the complementary strand. In DNA, the bases pair specifically: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). This complementary base pairing is essential for the structure of DNA and plays a crucial role in processes like DNA replication and transcription.


What does the "A" in DNA stand for?

The "A" in DNA stands for adenine.


What is a base that forms with thymine?

DNA!! the matching strands of rna form dna..


What do the lettters DNA stand for?

DNA stands for Deoxyribonucleic acid


What do the abbreviations DNA stand for?

DNA is an abbreviation for Deoxyribonucleic Acid.


What bases would match up to form a matching DNA strand from this pattern?

A pairs with T, C pairs with G. So the matching bases for a DNA strand with the pattern GATC would be CTAG.


What is a matching strand of DNA compared to AGTAAC?

A matching strand of DNA to the sequence AGTAAC would be its complementary strand, which consists of the bases that pair with each nucleotide. In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). Therefore, the complementary strand to AGTAAC would be TCATTG.


Doesn't DNA stand for deoxyribonucleic acid Sorry for spelling?

DNA does stand for deoxyribonucleic acid and you spelled it exactly right.


Is it possible to get an accurate DNA test from your father's brother to see if your father is actually your father?

It would not be accurate, but there would be some traces of matching dna.


What does the in DNA stand for?

deoxyribonucleic acid

Trending Questions
Why do the humerus and femur bones have rounded ends? Sadly for them these creatures can reproduce asexually Cut it in half and you get two new ones Cut off of its many arms and they will just grow back What are they? What size must an ecosystem? What are the all the tropic levels? What type of family when you lived with your both parents children and their siblings? Why do plant cells have cell wall but animal cells dot? What is that spot called when you look at a bright light and see a color? If and individual has one dominant allele and one recessive allele will the recessive allele show up? What is the name of a giant molecule consisting of the sugar deoxyribose phosphates and nitrogen bases that contains coded genetic information? What happens when the body is invaded by a germ? The cytoplasm of a cell is a solution of many different substances in? What is Ways in which living things respond to stimuli is called what? Which parenting style has the most consistently positive outcomes? What is the difference between the basal lamina and the basement membrane in terms of their structure and function? What was principle point of the Darwin theory of evolution? Where does the word fossil come from and what does the original word mean? What is the difference between a seed and a fruit? Which pair of events would directly result in a constant number of chromosomes in body ells from one generation to the next in sexually reproducing species? How come that when you put a tourniquet on the arm it becomes gangrened? Is a scientific hypothesis accepted as true after an experiments conclusion seems to support it?