The 2nd strand matching DNA refers to the strand that can pair with the original DNA sequence through complementary base pairing. In DNA replication, this matching strand is synthesized by DNA polymerase according to the sequence on the original template strand.
Analyzing VNTR DNA from DNA fingerprints is primarily used for identifying individuals and establishing biological relationships. This can be helpful in criminal investigations, paternity testing, and identifying victims in mass disasters. It is not typically used for matching tissues for transplantation.
The "A" in DNA stands for adenine.
A pairs with T, C pairs with G. So the matching bases for a DNA strand with the pattern GATC would be CTAG.
Base pairing in DNA replication ensures that the correct nucleotides are added to the new DNA strand, matching with their complementary bases. This contributes to the accuracy of DNA replication by reducing the chances of errors or mutations in the newly synthesized DNA strand.
During DNA replication, the enzyme DNA polymerase adds nucleotides to the growing DNA strand by matching them with the complementary nucleotides on the template strand. This process ensures accurate copying of the genetic information.
gaucgaucacucaggacuaug
Analyzing VNTR DNA from DNA fingerprints is primarily used for identifying individuals and establishing biological relationships. This can be helpful in criminal investigations, paternity testing, and identifying victims in mass disasters. It is not typically used for matching tissues for transplantation.
The matching DNA strand is called the complementary strand. In DNA, the bases pair specifically: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). This complementary base pairing is essential for the structure of DNA and plays a crucial role in processes like DNA replication and transcription.
The "A" in DNA stands for adenine.
DNA!! the matching strands of rna form dna..
DNA is an abbreviation for Deoxyribonucleic Acid.
DNA stands for Deoxyribonucleic acid
A pairs with T, C pairs with G. So the matching bases for a DNA strand with the pattern GATC would be CTAG.
A matching strand of DNA to the sequence AGTAAC would be its complementary strand, which consists of the bases that pair with each nucleotide. In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). Therefore, the complementary strand to AGTAAC would be TCATTG.
DNA does stand for deoxyribonucleic acid and you spelled it exactly right.
It would not be accurate, but there would be some traces of matching dna.
deoxyribonucleic acid