answersLogoWhite

0

The 2nd strand matching DNA refers to the strand that can pair with the original DNA sequence through complementary base pairing. In DNA replication, this matching strand is synthesized by DNA polymerase according to the sequence on the original template strand.

User Avatar

AnswerBot

1y ago

What else can I help you with?

Related Questions

During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?

gaucgaucacucaggacuaug


The two main purposes for analyzing vntr dna from dna fingerprints are matching tissues and inheritance?

Analyzing VNTR DNA from DNA fingerprints is primarily used for identifying individuals and establishing biological relationships. This can be helpful in criminal investigations, paternity testing, and identifying victims in mass disasters. It is not typically used for matching tissues for transplantation.


What does the "A" in DNA stand for?

The "A" in DNA stands for adenine.


What is a base that forms with thymine?

DNA!! the matching strands of rna form dna..


What do the abbreviations DNA stand for?

DNA is an abbreviation for Deoxyribonucleic Acid.


What do the lettters DNA stand for?

DNA stands for Deoxyribonucleic acid


What bases would match up to form a matching DNA strand from this pattern?

A pairs with T, C pairs with G. So the matching bases for a DNA strand with the pattern GATC would be CTAG.


What is a matching strand of DNA compared to AGTAAC?

A matching strand of DNA to the sequence AGTAAC would be its complementary strand, which consists of the bases that pair with each nucleotide. In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). Therefore, the complementary strand to AGTAAC would be TCATTG.


Doesn't DNA stand for deoxyribonucleic acid Sorry for spelling?

DNA does stand for deoxyribonucleic acid and you spelled it exactly right.


Is it possible to get an accurate DNA test from your father's brother to see if your father is actually your father?

It would not be accurate, but there would be some traces of matching dna.


What does the in DNA stand for?

deoxyribonucleic acid


What do DNA or RNA stand for?

DNA - Deoxyribonucleic acid RNA - Ribonucleic acid