answersLogoWhite

0

The matching DNA strand is called the complementary strand. In DNA, the bases pair specifically: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). This complementary base pairing is essential for the structure of DNA and plays a crucial role in processes like DNA replication and transcription.

User Avatar

AnswerBot

∙ 1y ago

What else can I help you with?

Continue Learning about Natural Sciences

What is a matching strand of DNA compared to AGTAAC?

A matching strand of DNA to the sequence AGTAAC would be its complementary strand, which consists of the bases that pair with each nucleotide. In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). Therefore, the complementary strand to AGTAAC would be TCATTG.


What enzyme is responsible for decodingthe DNA strand into an mRNA?

The enzyme responsible for decoding the DNA strand into an mRNA is called RNA polymerase. It catalyzes the synthesis of mRNA during transcription by matching complementary RNA nucleotides with the DNA template strand.


What is the term for the DNA strand that acts as a pattern to the newly synthesized DNA?

The DNA strand that acts as a pattern for the newly synthesized DNA is called the template strand. It serves as a guide during DNA replication, where complementary nucleotides are added to create a new DNA strand.


What is one strand of DNA that faces the opposite direction of the other strand called?

One strand of DNA that faces the opposite direction of the other strand is called the "antiparallel strand." In double-stranded DNA, one strand runs in the 5' to 3' direction, while the complementary strand runs in the 3' to 5' direction. This antiparallel arrangement is crucial for the processes of DNA replication and transcription.


What is the process called when DNA is copied into messenger RNA?

The process is called transcription. In transcription, RNA polymerase enzyme binds to a specific region on the DNA molecule and synthesizes a complementary mRNA strand by matching RNA nucleotides to the DNA template.

Related Questions

What is the 2nd stand matching DNA?

The 2nd strand matching DNA refers to the strand that can pair with the original DNA sequence through complementary base pairing. In DNA replication, this matching strand is synthesized by DNA polymerase according to the sequence on the original template strand.


During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?

gaucgaucacucaggacuaug


What is a matching strand of DNA compared to AGTAAC?

A matching strand of DNA to the sequence AGTAAC would be its complementary strand, which consists of the bases that pair with each nucleotide. In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). Therefore, the complementary strand to AGTAAC would be TCATTG.


What enzyme is responsible for decodingthe DNA strand into an mRNA?

The enzyme responsible for decoding the DNA strand into an mRNA is called RNA polymerase. It catalyzes the synthesis of mRNA during transcription by matching complementary RNA nucleotides with the DNA template strand.


How is DNA transcribed into mRNA?

DNA is transcribed into mRNA through a process called transcription. During transcription, an enzyme called RNA polymerase reads the DNA sequence and creates a complementary mRNA strand by matching nucleotides. This mRNA strand carries the genetic information from the DNA and serves as a template for protein synthesis.


How can one change DNA to mRNA?

To change DNA to mRNA, a process called transcription occurs. During transcription, an enzyme called RNA polymerase reads the DNA sequence and creates a complementary mRNA strand by matching nucleotides. This mRNA strand carries the genetic information from the DNA and can then be used to make proteins through a process called translation.


How can one convert DNA to mRNA?

To convert DNA to mRNA, a process called transcription occurs. During transcription, an enzyme called RNA polymerase reads the DNA sequence and creates a complementary mRNA strand by matching the nucleotides. This mRNA strand carries the genetic information from the DNA and can then be used by the cell to make proteins through a process called translation.


What bases would match up to form a matching DNA strand from this pattern?

A pairs with T, C pairs with G. So the matching bases for a DNA strand with the pattern GATC would be CTAG.


How does transcription go from 3 to 5 in the process of gene expression?

During transcription, the DNA strand is read by an enzyme called RNA polymerase. The RNA polymerase moves along the DNA strand and creates a complementary RNA strand by matching nucleotides. The process starts at the 3' end of the DNA strand and moves towards the 5' end, resulting in the production of an RNA molecule.


What is a single strand of DNA used for DNA testing called?

A single strand of DNA used for DNA testing is called PCR


How does the cell repair a double strand break in DNA?

When a cell encounters a double strand break in DNA, it activates a repair process called homologous recombination. In this process, the cell uses a matching DNA sequence from a sister chromatid as a template to repair the broken strands. Enzymes help align the broken DNA ends with the template, allowing for accurate repair of the double strand break.


What is the new strand called in Dna replication?

semiconservative replication - original DNA double strand will unwind into 2 strands, so one original strand will serve as a template for synthesizing a new complementary strand , thus forming a new DNA (one with old strand and one with a new strand)