0
If one strand of a DNA molecule has the sequence of bases 5'attgca3' the other complementary?
Wiki User
∙ 15y ago
Add your answer:
Earn +20 pts
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?
The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA
What would be the base sequence of the complementary mRNA strand?
TGCA
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?
The strand is called the parental strand. the gene being copied would depend on which protein is needed.
What sequence is the sequence of the complementary strand of DNA?
its tcaa
What is the sequence of complementary strand?
TGCA
If the DNA sequence is TAG what is the sequence of the complementary strand of tRNA?
auc
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What strand of DNA is use to make a complementary copy or to make a complementary mRNA molecule?
The template strand is used to make a complementary copy. This is a type of DNA strand.
What is the complementary base sequence of DNA strand?
TGCA
What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?
The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA
What would be the base sequence of the complementary mRNA strand?
TGCA
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What complementary strand to the DNA sequence TAGTCA is?
The DNA base pairing rules are A-T and C-G, so the complementary strand to TAGTCA is ATCAGT.
In the semi-conservative hyposistyesis of DNA replication what proportion of a parent DNA strand is contained by each daughter DNA strand?
The replication is semiconservative. Each strand acts as a template for the synthesis of a new DNA molecule by the sequential addition of complementary base pairs, thereby generating a new DNA strand that is the complementary sequence to the parental DNA. Each daughter DNA molecule ends up with one of the original strands and one newly synthesized strand.
What is the complementary strand of DNA?
Yes, strands of DNA are complementary. Complementary implies that a sequence of nucleotides (ex. ATATG) is ordered in a way that it directly corresponds to another sequence of nucleotides (ex. TATAC). Since DNA is double stranded in most circumstances, barring mutagenesis, one strand would be pair with its complementary strand, thus forming the double stand.
