answersLogoWhite

0

The complementary DNA strand would be AGC CTG GTA GCT. In DNA, adenine pairs with thymine and cytosine pairs with guanine. Therefore, the complementary strand is formed by replacing each base with its complementary base.

User Avatar

AnswerBot

1y ago

What else can I help you with?

Related Questions

If the sequence of nitrogenous bases is one standard of DNA is gta-gca the sequence of bases on its complementary DNA stand would be?

The complementary DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). Therefore, if one strand has the sequence gta-gca, the complementary strand would have the sequence cat-cgt.


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."


What sequence is the sequence of the complementary strand of DNA?

its tcaa


What is the sequence of complementary strand?

TGCA


Complementary dna sequence?

A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.


If the DNA sequence is TAG what is the sequence of the complementary strand of tRNA?

auc


What is the base sequence along the complementary region of the other strand of the double helix if one is GAATGC?

The complementary sequence to GAATGC is CTTACG. In DNA, adenine pairs with thymine, so if one strand has a guanine (G), the complementary strand will have a cytosine (C); and if one strand has an adenine (A), the complementary strand will have a thymine (T).


What is the complementary base sequence of DNA strand?

TGCA


What would be the base sequence of the complementary mRNA strand?

TGCA


What would the complementary strand for cttaggcttacca?

The complementary strand for cttaggcttacca would be gaatccgaatggt. This is formed by pairing adenine with thymine and cytosine with guanine on the opposite strand.


What complementary strand to the DNA sequence TAGTCA is?

The DNA base pairing rules are A-T and C-G, so the complementary strand to TAGTCA is ATCAGT.


The nucleotide base sequence of a strand of DNA is TAC-CGG-AGT. What is the sequence of the complementary DNA strand?

The complementary DNA strand to TAC-CGG-AGT is ATG-GCC-TCA. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G), so the complementary strand is created by matching these base pairs.