Tags Genetics

Animals & Plants Arts & Entertainment Auto Beauty & Health Books and Literature Business Electronics Engineering & Technology Food & Drink History Hobbies Jobs & Education Law & Government Math People & Society Science Social Studies Sports Travel & Places

0

A strand of dna contains the base sequence AGTTwhat is the sequence of the complementary strand of DNA?

Updated: 8/21/2019

Estefanichavez5095fb... ∙

Lvl 1

∙ 9y ago

Best Answer

tcaa --remember a attracts t while c attracts g

Wiki User

∙ 9y ago

This answer is:

Add your answer:

Earn +20 pts

Q: A strand of dna contains the base sequence AGTTwhat is the sequence of the complementary strand of DNA?

Write your answer...

Submit

Still have questions?

imp

Related questions

What sequence is the sequence of the complementary strand of DNA?

its tcaa

What is the sequence of complementary strand?

TGCA

If the DNA sequence is TAG what is the sequence of the complementary strand of tRNA?

auc

Complementary dna sequence?

A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.

What is the complementary strand of DNA?

Yes, strands of DNA are complementary. Complementary implies that a sequence of nucleotides (ex. ATATG) is ordered in a way that it directly corresponds to another sequence of nucleotides (ex. TATAC). Since DNA is double stranded in most circumstances, barring mutagenesis, one strand would be pair with its complementary strand, thus forming the double stand.

What is the complementary base sequence of DNA strand?

TGCA

What would be the base sequence of the complementary mRNA strand?

TGCA

What is the complementary sequence for atgcccgggtgtcgtagttga?

The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.

What is the complementary DNA?

A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?

What is the complementary DNA strands?

A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?

What complementary strand to the DNA sequence TAGTCA is?

The DNA base pairing rules are A-T and C-G, so the complementary strand to TAGTCA is ATCAGT.

A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?

The complimentary strand of MRNA would be AAUUCCGG.

Trending Questions

What is a behavior diary? When did Odie first appear in Garfield? Can the elf on the shelf have different personality? What is a tailoring thoracoplasty? Is Julian R Eastman Sam Westing? What was one of the reasons the old Receivers trainee had failed in the giver? What has the author Troon McAllister written? What is a summary for a fall of marigolds? What does crude mean from the book Where the Red Fern Grows? What does Curley's wife say she could have down instead marrying Curley? What surprises Alice that the footman DOESN'T resond to? What did Jacob Marley do wrong when he was alive in Christmas carol? What has the author Tor Andrae written? Stress Management Will Improve Your Life? What is the size of the Mayan calendar? Where to download skulduggery pleasant e-books? Why were the pebbles piled upon the spurt of the water Tuck Everlasting? Conflict in the story of Luigi Pirandello? What is the plot summary of 'Her First Ball'? What does Christmas have to do with her tears The gift of the magi?

Still have questions?

imp

Previously Viewed

A strand of dna contains the base sequence AGTTwhat is the sequence of the complementary strand of DNA?

Resources

Top Categories

Product

Company

Copyright ©2024 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.