0
What would be the base sequence for the complementary DNA formed from CGT TA?
Wiki User
∙ 12y ago
ACGGTA
Wiki User
∙ 11y ago
Wiki User
∙ 12y agoGCAAT
Add your answer:
Earn +20 pts
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What is the sequence of the complementary DNA strand gaattcggca?
Simple you just look at what base it is then what ever base would be complementary to it, is your answer. ATTGTCCAGT is your answer
What would be the base sequence of the complementary mRNA strand?
TGCA
What is the complementary sequence for this DNA c-t-a-a-g-t-c?
To find the complementary sequence for a given DNA sequence, you need to match each nucleotide with its complementary base according to the base-pairing rules. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Given the DNA sequence: C - T - A - A - G - T - C The complementary sequence would be: G - A - T - T - C - A - G
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What is the sequence of the complementary DNA strand gaattcggca?
Simple you just look at what base it is then what ever base would be complementary to it, is your answer. ATTGTCCAGT is your answer
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
What would be the mrna base sequence formed during transcription using the DNA sequence below?
Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.
What is the complementary base sequence of cagttagc-oh?
A binds with T, C binds with G. Therefore the complementary DNA sequence will be GTCAATCG. The complementary RNA would be CAGTTAGC. The OH means it is the 3' end - so the complementary strand would be 5' at the same spot.
What is the complementary base sequence of DNA strand?
TGCA
What would be the base sequence of the complementary mRNA strand?
TGCA
What would the complementary strand of DNA be for the sequence of the base Cttaggcttacca?
lol i hate this question........its in meh science book
What is reverse complement?
The reverse complement is the DNA sequence reversed and then its complementary base pairs. For example, I have a sequence: ATGGGCCT so the reverse complement would be AGGCCCAT
During DNA replication what sequence on complementary base pairs will be match to the following sequence ATACGCGTTA?
ji
What is the complementary sequence for this DNA c-t-a-a-g-t-c?
To find the complementary sequence for a given DNA sequence, you need to match each nucleotide with its complementary base according to the base-pairing rules. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Given the DNA sequence: C - T - A - A - G - T - C The complementary sequence would be: G - A - T - T - C - A - G
What is a characteristic of nucleic acids in which the sequence of bases on one strand is paired to the sequence of bases on the other?
Complementary Base- pairs
