0
What would be the base sequence for the complementary DNA formed from CGT TA?
Wiki User
∙ 12y ago
ACGGTA
Wiki User
∙ 11y ago
Add your answer:
Earn +20 pts
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
A gene has the base sequence that starts with TCG GAC CAT CGA a) What would be the complementary DNA strand formed from this DNA ing?
The complementary DNA strand would be AGC CTG GTA GCT. In DNA, adenine pairs with thymine and cytosine pairs with guanine. Therefore, the complementary strand is formed by replacing each base with its complementary base.
What is the sequence of the complementary DNA strand gaattcggca?
The complementary DNA strand for "gaattcggca" would be "cttaagccgt." In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). So you would replace each base according to these rules to find the complementary sequence.
What would be the base sequence of the complementary mRNA strand?
TGCA
What is CCGTAGGCC?
CCGTAGGCC is a sequence of DNA base pairs. It represents the complementary DNA strand to the original sequence GGCTACGG, where each base pairs with its complementary base (A with T and C with G).
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
A gene has the base sequence that starts with TCG GAC CAT CGA a) What would be the complementary DNA strand formed from this DNA ing?
The complementary DNA strand would be AGC CTG GTA GCT. In DNA, adenine pairs with thymine and cytosine pairs with guanine. Therefore, the complementary strand is formed by replacing each base with its complementary base.
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
What would be the mrna base sequence formed during transcription using the DNA sequence below?
Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.
What is the sequence of the complementary DNA strand gaattcggca?
The complementary DNA strand for "gaattcggca" would be "cttaagccgt." In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). So you would replace each base according to these rules to find the complementary sequence.
What would be the base sequence of the complementary mRNA strand?
TGCA
What is the complementary base sequence of cagttagc-oh?
A binds with T, C binds with G. Therefore the complementary DNA sequence will be GTCAATCG. The complementary RNA would be CAGTTAGC. The OH means it is the 3' end - so the complementary strand would be 5' at the same spot.
What is CCGTAGGCC?
CCGTAGGCC is a sequence of DNA base pairs. It represents the complementary DNA strand to the original sequence GGCTACGG, where each base pairs with its complementary base (A with T and C with G).
What is the complementary base sequence of DNA strand?
TGCA
What is the A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complementary base pairing rule for DNA and mRNA is: A pairs with U, T pairs with A, G pairs with C, and C pairs with G. Therefore, the mRNA complementary strand for the DNA sequence TTAAGGCC would be AAUUCCGG.
What is the dna segment of ugauuc from mRNA?
The DNA segment complementary to the mRNA sequence "UGAUUC" would be "ACTAAG". This is because in DNA, adenine pairs with thymine and cytosine pairs with guanine. Thus, the complementary DNA sequence of the mRNA sequence is determined by replacing each base with its complementary base.
What would the complementary strand of DNA be for the sequence of the base Cttaggcttacca?
lol i hate this question........its in meh science book
