answersLogoWhite

0

ACGGTA

User Avatar

Wiki User

13y ago

What else can I help you with?

Related Questions

What is the complementary sequence for atgcccgggtgtcgtagttga?

The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."


What is the complementary base sequence of the DNA strand if the template strand reads TTGCACG?

The complementary base sequence of a DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). For the template strand TTGCACG, the complementary sequence would be AACGTGC.


A gene has the base sequence that starts with TCG GAC CAT CGA a) What would be the complementary DNA strand formed from this DNA ing?

The complementary DNA strand would be AGC CTG GTA GCT. In DNA, adenine pairs with thymine and cytosine pairs with guanine. Therefore, the complementary strand is formed by replacing each base with its complementary base.


Which base sequence in DNA is complementary to the base sequence atgt?

ATAGCC is complementary to the base sequence TATCGG.


Base Sequence CGT ACG GCT AC WHAT WOULD BE the base sequence formed by transcription?

During transcription, the DNA sequence is converted into a complementary RNA sequence. For the given DNA base sequence CGT ACG GCT AC, the corresponding RNA sequence would be GCA UGC CGA UG. This involves replacing thymine (T) with uracil (U) in RNA.


What base sequence would be produced through TAGGTAACT?

The base sequence produced from the DNA strand TAGGTAACT would be its complementary strand. In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). Therefore, the complementary sequence would be ATCCATTGA.


What would be the mrna base sequence formed during transcription using the DNA sequence below?

Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.


What is the sequence of the complementary DNA strand gaattcggca?

The complementary DNA strand for "gaattcggca" would be "cttaagccgt." In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). So you would replace each base according to these rules to find the complementary sequence.


What would be the base sequence of the complementary mRNA strand?

TGCA


What is the complementary base sequence of cagttagc-oh?

A binds with T, C binds with G. Therefore the complementary DNA sequence will be GTCAATCG. The complementary RNA would be CAGTTAGC. The OH means it is the 3' end - so the complementary strand would be 5' at the same spot.


What is the complementary DNA base sequence for the following bases AACT?

The complementary DNA base sequence for AACT is TTGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original sequence is replaced by its complementary base.


What is the base sequence of the original DNA segment?

To determine the base sequence of the original DNA segment, you would need to know the complementary base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). If you have a sequence of the complementary DNA strand, you can reverse the pairs to identify the original sequence. Without the specific complementary sequence provided, the original DNA segment cannot be determined.