0
What else can I help you with?
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
During DNA replication what sequence on complementary base pairs will be match to the following sequence ATACGCGTTA?
ji
What base sequence would be produced through TAGGTAACT?
The base sequence produced from the DNA strand TAGGTAACT would be its complementary strand. In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). Therefore, the complementary sequence would be ATCCATTGA.
In a DNA molecule what base sequence is complementary to the sequence CGAC?
The base sequence complementary to CGAC in a DNA molecule is GCTG. In DNA, cytosine (C) pairs with guanine (G), and adenine (A) pairs with thymine (T), so you would replace each base with its complementary counterpart. Therefore, C pairs with G, G pairs with C, A pairs with T, and C pairs with G.
DNA sequence acgtt will give what mRNA base sequence?
The mRNA base sequence corresponding to the DNA sequence acgtt is ugcaa. The mRNA sequence is complementary to the DNA sequence, with thymine (T) in DNA being replaced by uracil (U) in mRNA.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
What is CCGTAGGCC?
CCGTAGGCC is a sequence of DNA base pairs. It represents the complementary DNA strand to the original sequence GGCTACGG, where each base pairs with its complementary base (A with T and C with G).
What is the complementary base sequence of DNA strand?
TGCA
During DNA replication what sequence on complementary base pairs will be match to the following sequence ATACGCGTTA?
ji
What would be the base sequence for the complementary DNA formed from CGT TA?
The base sequence for the complementary DNA would be GCA AT. Since DNA strands are complementary, the bases pair as follows: A with T, T with A, C with G, and G with C.
What would be the base sequence of the complementary mRNA strand?
TGCA
What is the sequence of the complementary DNA strand gaattcggca?
The complementary DNA strand for "gaattcggca" would be "cttaagccgt." In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). So you would replace each base according to these rules to find the complementary sequence.
In a DNA molecule what base sequence is complementary to the sequence CGAC?
The base sequence complementary to CGAC in a DNA molecule is GCTG. In DNA, cytosine (C) pairs with guanine (G), and adenine (A) pairs with thymine (T), so you would replace each base with its complementary counterpart. Therefore, C pairs with G, G pairs with C, A pairs with T, and C pairs with G.
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What is the dna segment of ugauuc from mRNA?
The DNA segment complementary to the mRNA sequence "UGAUUC" would be "ACTAAG". This is because in DNA, adenine pairs with thymine and cytosine pairs with guanine. Thus, the complementary DNA sequence of the mRNA sequence is determined by replacing each base with its complementary base.
DNA sequence acgtt will give what mRNA base sequence?
The mRNA base sequence corresponding to the DNA sequence acgtt is ugcaa. The mRNA sequence is complementary to the DNA sequence, with thymine (T) in DNA being replaced by uracil (U) in mRNA.
