answersLogoWhite

0

A binds with T, C binds with G.

Therefore the complementary DNA sequence will be GTCAATCG.

The complementary RNA would be CAGTTAGC.

The OH means it is the 3' end - so the complementary strand would be 5' at the same spot.

User Avatar

Wiki User

14y ago

What else can I help you with?

Related Questions

What is the complementary sequence for atgcccgggtgtcgtagttga?

The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."


What is the complementary DNA base sequence for the following bases AACT?

The complementary DNA base sequence for AACT is TTGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original sequence is replaced by its complementary base.


Which base sequence in DNA is complementary to the base sequence atgt?

ATAGCC is complementary to the base sequence TATCGG.


What is CCGTAGGCC?

CCGTAGGCC is a sequence of DNA base pairs. It represents the complementary DNA strand to the original sequence GGCTACGG, where each base pairs with its complementary base (A with T and C with G).


What is the complementary base sequence of DNA strand?

TGCA


What is the complementary base sequence of the DNA strand if the template strand reads TTGCACG?

The complementary base sequence of a DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). For the template strand TTGCACG, the complementary sequence would be AACGTGC.


What is the base sequence of the original DNA segment?

To determine the base sequence of the original DNA segment, you would need to know the complementary base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). If you have a sequence of the complementary DNA strand, you can reverse the pairs to identify the original sequence. Without the specific complementary sequence provided, the original DNA segment cannot be determined.


During DNA replication what sequence on complementary base pairs will be match to the following sequence ATACGCGTTA?

ji


What would be the base sequence for the complementary DNA formed from CGT TA?

The base sequence for the complementary DNA would be GCA AT. Since DNA strands are complementary, the bases pair as follows: A with T, T with A, C with G, and G with C.


Why can you predict the base sequence of one strand in amloecule of DNA if you know the sequence of the other stand?

You can predict the base sequence of one strand of DNA if you know the sequence of the other strand because DNA strands are complementary. Adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). This complementary base pairing allows the sequence of one strand to dictate the sequence of the other, enabling accurate predictions of the base sequence.


What would be the base sequence of the complementary mRNA strand?

TGCA


What is the complimentary of GCTAACTGGC?

The complementary DNA sequence of GCTAACTGGC is CGATTGACC. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G), so each base in the original sequence is replaced by its complementary base.