ji
To determine the DNA replication strand for the sequence ATGCATTGACGGTACCGATACATCAT, you need to find the complementary bases. The complementary strand would be TACGTAACCTGCCATGGCTATGTAGTA, where adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G).
The complementary strand to yours would be ATGCAA. Just remember that T is complementary to A and C is complementary to G.
The complementary DNA base sequence for AACT is TTGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original sequence is replaced by its complementary base.
The genetic code on the complementary strand refers to the sequence of nucleotides that pairs with a corresponding sequence on the original DNA strand. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, if the original strand has a sequence like ACGT, the complementary strand would have the sequence TGCA. This complementary base pairing is crucial for DNA replication and transcription processes.
Assuming RNA (U): TUUGUUU Assuming DNA: TAAGAAA
To determine the DNA replication strand for the sequence ATGCATTGACGGTACCGATACATCAT, you need to find the complementary bases. The complementary strand would be TACGTAACCTGCCATGGCTATGTAGTA, where adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G).
The complementary base to adenine (A) is thymine (T), and the complementary base to cytosine (C) is guanine (G). Therefore, during DNA replication, the complementary sequence to gatcgt would be ctagca.
The complementary strand to yours would be ATGCAA. Just remember that T is complementary to A and C is complementary to G.
The complementary DNA base sequence for AACT is TTGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original sequence is replaced by its complementary base.
The genetic code on the complementary strand refers to the sequence of nucleotides that pairs with a corresponding sequence on the original DNA strand. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, if the original strand has a sequence like ACGT, the complementary strand would have the sequence TGCA. This complementary base pairing is crucial for DNA replication and transcription processes.
The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
Assuming RNA (U): TUUGUUU Assuming DNA: TAAGAAA
The replicated nucleotide sequence will be CGTCGCCTA. This is because in DNA replication, adenine (A) pairs with thymine (T) and guanine (G) pairs with cytosine (C), so the complementary sequence of GCAGCGGAT will be CGTCGCCTA.
The complimentary strand of MRNA would be AAUUCCGG.
The complementary base pairing rule for DNA and mRNA is: A pairs with U, T pairs with A, G pairs with C, and C pairs with G. Therefore, the mRNA complementary strand for the DNA sequence TTAAGGCC would be AAUUCCGG.