0
During DNA replication what sequence on complementary base pairs will be match to the following sequence ATACGCGTTA?
ji
What else can I help you with?
If DNA aattgccgt what is its complement?
The complementary strand to yours would be ATGCAA. Just remember that T is complementary to A and C is complementary to G.
What is the complementary strand to the following sequence UTTCTTT?
Assuming RNA (U): TUUGUUU Assuming DNA: TAAGAAA
Which nucleotide sequence will be replicated from a stretch of DNA with the sequence gcagcggat?
The replicated nucleotide sequence will be CGTCGCCTA. This is because in DNA replication, adenine (A) pairs with thymine (T) and guanine (G) pairs with cytosine (C), so the complementary sequence of GCAGCGGAT will be CGTCGCCTA.
The strict arrangement of base-pairings in the double helix results in 2 strands of nucleotides that are?
complementary to each other, meaning that the sequence of bases in one strand determines the sequence in the other strand. This allows for accurate replication of genetic information during cell division and ensures genetic stability in offspring.
What is the complementary nucleotide sequence of ccgagattg?
The complementary nucleotide sequence of ccgagattg is ggctctaac.
What is complementary to gatcgt during dna replication?
The complementary base to adenine (A) is thymine (T), and the complementary base to cytosine (C) is guanine (G). Therefore, during DNA replication, the complementary sequence to gatcgt would be ctagca.
If DNA aattgccgt what is its complement?
The complementary strand to yours would be ATGCAA. Just remember that T is complementary to A and C is complementary to G.
What sequence is complementary to aggtac?
The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What is the complementary strand to the following sequence UTTCTTT?
Assuming RNA (U): TUUGUUU Assuming DNA: TAAGAAA
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
Which nucleotide sequence will be replicated from a stretch of DNA with the sequence gcagcggat?
The replicated nucleotide sequence will be CGTCGCCTA. This is because in DNA replication, adenine (A) pairs with thymine (T) and guanine (G) pairs with cytosine (C), so the complementary sequence of GCAGCGGAT will be CGTCGCCTA.
What is the A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complementary base pairing rule for DNA and mRNA is: A pairs with U, T pairs with A, G pairs with C, and C pairs with G. Therefore, the mRNA complementary strand for the DNA sequence TTAAGGCC would be AAUUCCGG.
What be would the complementary strand of DNA for the following sequence of bases?
lol i hate this question........its in meh science book
What is the complementary nucleotide sequence of ccgagattg?
The complementary nucleotide sequence of ccgagattg is ggctctaac.
What is complementary sequence?
When DNA and/or RNA are in the double helix configuration each helix is the complementary sequence of the other.
