answersLogoWhite

0

To determine the DNA replication strand for the sequence ATGCATTGACGGTACCGATACATCAT, you need to find the complementary bases. The complementary strand would be TACGTAACCTGCCATGGCTATGTAGTA, where adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G).

User Avatar

AnswerBot

1mo ago

What else can I help you with?

Continue Learning about Natural Sciences

What enzyne produces a new DNA strand during DNA replication?

DNA polymerase is the enzyme responsible for producing a new DNA strand during DNA replication. It catalyzes the addition of nucleotides to the growing DNA chain, using the existing DNA strand as a template.


Semiconservative replication involes a template what is the template?

The template for semiconservative replication is the original DNA strand that serves as a guide for creating a new complementary strand. During DNA replication, each original parental strand acts as a template for the synthesis of a new daughter strand.


How many strands are replicated in DNA replication?

During DNA replication, two strands of the double-stranded DNA molecule are unwound and each strand serves as a template for the synthesis of a new complementary strand, resulting in the formation of two new DNA molecules, each composed of one original strand and one newly synthesized strand.


WHAT IS THE OLD STRAND OF DNA REPLICATION?

The old strand of DNA replication, often referred to as the "template strand," serves as the guide for synthesizing a new complementary strand during DNA replication. In this semi-conservative process, each new DNA double helix consists of one original (old) strand and one newly synthesized strand. This ensures that genetic information is accurately preserved and passed on during cell division. The replication occurs at specific sites called origins of replication, where various enzymes, including DNA polymerase, facilitate the process.


Is it DNA Copying or DNA Replication?

DNA copying and DNA replication are interchangeable terms that refer to the process of making an exact copy of a DNA molecule. During this process, the double-stranded DNA unwinds, and each strand serves as a template for the synthesis of a new complementary strand.

Related Questions

What is the role of the leading strand in DNA replication?

The leading strand in DNA replication serves as a template for the continuous synthesis of a new complementary strand of DNA. It is replicated in a continuous manner by DNA polymerase, allowing for efficient and accurate replication of the entire DNA molecule.


What is the DNA strand that is synthesized continuously during DNA replication?

The leading strand is the DNA strand that is synthesized continuously during DNA replication. This is because the polymerase enzyme can add nucleotides in the 5' to 3' direction without interruption as the replication fork opens.


What enzyne produces a new DNA strand during DNA replication?

DNA polymerase is the enzyme responsible for producing a new DNA strand during DNA replication. It catalyzes the addition of nucleotides to the growing DNA chain, using the existing DNA strand as a template.


What happens at the DNA replication fork?

The DNA replication fork is where the replication origin forms the Y shape. The replication fork moves down the DNA strand to the strand's end, resulting in every replication fork having a twin.


Semiconservative replication involes a template what is the template?

The template for semiconservative replication is the original DNA strand that serves as a guide for creating a new complementary strand. During DNA replication, each original parental strand acts as a template for the synthesis of a new daughter strand.


What is the new strand called in Dna replication?

semiconservative replication - original DNA double strand will unwind into 2 strands, so one original strand will serve as a template for synthesizing a new complementary strand , thus forming a new DNA (one with old strand and one with a new strand)


What acts as the origianl template in DNA replication?

A strand of DNA


How many strands are replicated in DNA replication?

During DNA replication, two strands of the double-stranded DNA molecule are unwound and each strand serves as a template for the synthesis of a new complementary strand, resulting in the formation of two new DNA molecules, each composed of one original strand and one newly synthesized strand.


What are the fragments making up the noncontinuous strand called?

The fragments making up the noncontinuous strand in DNA replication are called Okazaki fragments. These are short DNA fragments that are synthesized discontinuously on the lagging strand during DNA replication.


In what direction does DNA replication occur from 5' to 3' on the template strand?

Yes, DNA replication occurs in the 5' to 3' direction on the template strand.


At the end of replication each new DNA molecule is composed of?

After DNA replication, each new molecule has one strand of the original DNA molecule and the other strand is composed of new nucleic acids. This is due to the semi-conservative replication of DNA.


What is the function of DNA polymerase 3 in the process of DNA replication?

DNA polymerase 3 is an enzyme that adds nucleotides to the growing DNA strand during replication. It is responsible for synthesizing the majority of the new DNA strand by adding complementary nucleotides to the template strand.