Ggc tct aac
The complementary nucleotide sequence to a sticky end sequence on human DNA would be its reverse complement sequence. For example, if the sticky end sequence is "AATT", its complementary sequence would be "TTAA".
RNA polymerase is the enzyme that reads along a sequence of bases in DNA and synthesizes a complementary sequence of nucleotide bases in RNA during transcription.
If the sticky end of a sequence is TTAA, it can bind to a DNA molecule with the sequence AATT
Correct match for CTAGG is.... GATCC ;)
The right chain of the DNA molecule will have a complementary nucleotide sequence to the left chain. For the sequence CCGTAGGCC, the complementary bases are as follows: C pairs with G, G pairs with C, T pairs with A, A pairs with T. Therefore, the sequence of the right chain will be GGCA TCCGG.
The complementary nucleotide sequence to a sticky end sequence on human DNA would be its reverse complement sequence. For example, if the sticky end sequence is "AATT", its complementary sequence would be "TTAA".
RNA polymerase is the enzyme that reads along a sequence of bases in DNA and synthesizes a complementary sequence of nucleotide bases in RNA during transcription.
transcription
If the sticky end of a sequence is TTAA, it can bind to a DNA molecule with the sequence AATT
Transcription.
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
Correct match for CTAGG is.... GATCC ;)
If one strand of DNA has a nucleotide base sequence of tcaggtccat, its complementary strand is agtccaggta. Adenine pairs with thymine, while guanine pairs with cytosine.
The right chain of the DNA molecule will have a complementary nucleotide sequence to the left chain. For the sequence CCGTAGGCC, the complementary bases are as follows: C pairs with G, G pairs with C, T pairs with A, A pairs with T. Therefore, the sequence of the right chain will be GGCA TCCGG.
Transcription is the process in which a complementary RNA sequence is synthesized from a DNA template strand. This process occurs in the cell nucleus and is carried out by the enzyme RNA polymerase.
The replicated nucleotide sequence will be CGTCGCCTA. This is because in DNA replication, adenine (A) pairs with thymine (T) and guanine (G) pairs with cytosine (C), so the complementary sequence of GCAGCGGAT will be CGTCGCCTA.
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.