answersLogoWhite

0

Ggc tct aac

User Avatar

Wiki User

16y ago

What else can I help you with?

Related Questions

List the two nucleotide sequence that are complementary to the sticky end sequence on the human DNA?

The complementary nucleotide sequence to a sticky end sequence on human DNA would be its reverse complement sequence. For example, if the sticky end sequence is "AATT", its complementary sequence would be "TTAA".


An enzyme that reads along a sequence of bases in DNA making a complementary sequence of nucleotide bases in RNA is?

RNA polymerase is the enzyme that reads along a sequence of bases in DNA and synthesizes a complementary sequence of nucleotide bases in RNA during transcription.


Rna molecules are produced by copying part of the nucleotide sequence of DNA into a complementary sequence in rna?

transcription


If the sticky end of a nucleotide sequence is TTAA what is next?

If the sticky end of a sequence is TTAA, it can bind to a DNA molecule with the sequence AATT


During what process are rna molecules produced by copying part of the nucleotide sequence of dna into a complementary sequence in rna?

Transcription.


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."


Correct matching nucleotide sequence for CTAGG?

Correct match for CTAGG is.... GATCC ;)


If one strand of DNA has a nucleotide base sequence of tcaggtccat?

If one strand of DNA has a nucleotide base sequence of tcaggtccat, its complementary strand is agtccaggta. Adenine pairs with thymine, while guanine pairs with cytosine.


If the left chain of the DNA molecule has the nucleotide sequence CCGTAGGCC what is the sequence of the right chain of the DNA molecule?

The right chain of the DNA molecule will have a complementary nucleotide sequence to the left chain. For the sequence CCGTAGGCC, the complementary bases are as follows: C pairs with G, G pairs with C, T pairs with A, A pairs with T. Therefore, the sequence of the right chain will be GGCA TCCGG.


What is it called when copying part of a nucleotide sequence of dna into a complementary sequence in rna?

Transcription is the process in which a complementary RNA sequence is synthesized from a DNA template strand. This process occurs in the cell nucleus and is carried out by the enzyme RNA polymerase.


Which nucleotide sequence will be replicated from a stretch of DNA with the sequence gcagcggat?

The replicated nucleotide sequence will be CGTCGCCTA. This is because in DNA replication, adenine (A) pairs with thymine (T) and guanine (G) pairs with cytosine (C), so the complementary sequence of GCAGCGGAT will be CGTCGCCTA.


If a DNA strand had the sequence CCGAGATTG what is the nucloetide sequence of the complimentary strand?

It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.