0
What else can I help you with?
During what process are rna molecules produced by copying part of the nucleotide sequence of dna into a complementary sequence in rna?
Transcription.
What is the complementary nucleotide sequence of ccgagattg?
The complementary nucleotide sequence of ccgagattg is ggctctaac.
List the two nucleotide sequence that are complementary to the sticky end sequence on the human DNA?
The complementary nucleotide sequence to a sticky end sequence on human DNA would be its reverse complement sequence. For example, if the sticky end sequence is "AATT", its complementary sequence would be "TTAA".
What role in transcription play in protein synthesis?
RNA molecules are produced by copying part of the nucleus sequence of DNA into a complementary sequence in RNA.
An enzyme that reads along a sequence of bases in DNA making a complementary sequence of nucleotide bases in RNA is?
RNA polymerase is the enzyme that reads along a sequence of bases in DNA and synthesizes a complementary sequence of nucleotide bases in RNA during transcription.
If the sticky end of a nucleotide sequence is TTAA what is next?
If the sticky end of a sequence is TTAA, it can bind to a DNA molecule with the sequence AATT
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
Correct matching nucleotide sequence for CTAGG?
Correct match for CTAGG is.... GATCC ;)
If one strand of DNA has a nucleotide base sequence of tcaggtccat?
If one strand of DNA has a nucleotide base sequence of tcaggtccat, its complementary strand is agtccaggta. Adenine pairs with thymine, while guanine pairs with cytosine.
Cluster of three nucleotides?
A cluster of three nucleotides is called a 'codon' - However, the term is only really used to refer to refer to a 3 nucleotide sequence on an mRNA molecule. Codons provide a means by which charged tRNA molecules can specifically add amino acids to a growing polypeptide chain. tRNA molecules have the complementary 3 nucleotide sequence (anticodon) that allow the specific recognition.
If the left chain of the DNA molecule has the nucleotide sequence CCGTAGGCC what is the sequence of the right chain of the DNA molecule?
The right chain of the DNA molecule will have a complementary nucleotide sequence to the left chain. For the sequence CCGTAGGCC, the complementary bases are as follows: C pairs with G, G pairs with C, T pairs with A, A pairs with T. Therefore, the sequence of the right chain will be GGCA TCCGG.
In this strand of DNA was used that would be the complementary DNA Produced?
To determine the complementary DNA strand produced from a given DNA sequence, you need to match each nucleotide with its complementary base: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the original DNA strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'. The directionality of the strands is also important, so ensure to maintain the 5' to 3' orientation when writing the complementary sequence.
