It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
lol i hate this question........its in meh science book
taacgggtac
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
The genetic code on the complementary strand refers to the sequence of nucleotides that pairs with a corresponding sequence on the original DNA strand. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, if the original strand has a sequence like ACGT, the complementary strand would have the sequence TGCA. This complementary base pairing is crucial for DNA replication and transcription processes.
DNA usually comes in a double stranded helix, but if there is only one strand provided, complimentary base pairing occurs. Adenine and Thymine pair, as do Guanine and Cytosine. Given a sequence of DNA, using this, you can find its complementary strand.
The complimentary strand of MRNA would be AAUUCCGG.
The sequence would be GACGGT
lol i hate this question........its in meh science book
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
taacgggtac
It's complimentary pair. C--G and T--A
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
The genetic code on the complementary strand refers to the sequence of nucleotides that pairs with a corresponding sequence on the original DNA strand. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, if the original strand has a sequence like ACGT, the complementary strand would have the sequence TGCA. This complementary base pairing is crucial for DNA replication and transcription processes.
The complementary strand to tagcaagc would be ATCGTTCG. In DNA, adenine (A) pairs with thymine (T), while cytosine (C) pairs with guanine (G). So, the complementary bases are matched accordingly to form the opposite strand.
AATCGCCGTTA
DNA usually comes in a double stranded helix, but if there is only one strand provided, complimentary base pairing occurs. Adenine and Thymine pair, as do Guanine and Cytosine. Given a sequence of DNA, using this, you can find its complementary strand.