0
What else can I help you with?
What is the complimentary strand for DNA for the sequence base of cttaggcttacca?
lol i hate this question........its in meh science book
What is the complementary sequence of bases in the strand of DNA AACCCTGAGTCT?
taacgggtac
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
What is the genetic code on the complimentary stand?
The genetic code on the complementary strand refers to the sequence of nucleotides that pairs with a corresponding sequence on the original DNA strand. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, if the original strand has a sequence like ACGT, the complementary strand would have the sequence TGCA. This complementary base pairing is crucial for DNA replication and transcription processes.
How do you find a complimentry strand of DNA?
DNA usually comes in a double stranded helix, but if there is only one strand provided, complimentary base pairing occurs. Adenine and Thymine pair, as do Guanine and Cytosine. Given a sequence of DNA, using this, you can find its complementary strand.
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
What would be the complimentary sequence of bases produced by a DNA strand with bases CTGCCA?
The sequence would be GACGGT
What is the complimentary strand for DNA for the sequence base of cttaggcttacca?
lol i hate this question........its in meh science book
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What is the complementary sequence of bases in the strand of DNA AACCCTGAGTCT?
taacgggtac
What determines the sequence of the nitrogenous bases in a new DNA strand?
It's complimentary pair. C--G and T--A
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
What is the genetic code on the complimentary stand?
The genetic code on the complementary strand refers to the sequence of nucleotides that pairs with a corresponding sequence on the original DNA strand. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, if the original strand has a sequence like ACGT, the complementary strand would have the sequence TGCA. This complementary base pairing is crucial for DNA replication and transcription processes.
If a DNA stand sequence tagcaagc what will be the complimentary strand?
The complementary strand to tagcaagc would be ATCGTTCG. In DNA, adenine (A) pairs with thymine (T), while cytosine (C) pairs with guanine (G). So, the complementary bases are matched accordingly to form the opposite strand.
WHAT IS THE COMPLIMENTARY STRAND TO TTAGCGGCAAT?
AATCGCCGTTA
How do you find a complimentry strand of DNA?
DNA usually comes in a double stranded helix, but if there is only one strand provided, complimentary base pairing occurs. Adenine and Thymine pair, as do Guanine and Cytosine. Given a sequence of DNA, using this, you can find its complementary strand.
