AATCGCCGTTA
3' aatgcccaggtcagtacgct 5' is the complimentary strand.
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
acg-att
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
taacgggtac
B. Complimentary
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
lol i hate this question........its in meh science book
The complementary strand for bases AAGCCA would be TTCGGT. In DNA, adenine pairs with thymine and guanine pairs with cytosine.
The complementary strand to GCCATTG would be CGGTAAC. Adenine pairs with thymine and guanine pairs with cytosine in DNA strands.
The complimentary strand of MRNA would be AAUUCCGG.
A pairs only with T, and C pairs only with G. You know this is DNA (instead of RNA) because it has T instead of U. A = Adenine, T = Thymine, C = Cytosine, and G = Guanine An example: One strand: CGATCCGA Complimentary: GCTAGGCT Now you know enough to solve the problem on your own.