The complementary strand to GCCATTG would be CGGTAAC. Adenine pairs with thymine and guanine pairs with cytosine in DNA strands.
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
G=C, G=C, T=A, A= T So, to answer the question: CGGTAAC
taacgggtac
lol i hate this question........its in meh science book
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
G=C, G=C, T=A, A= T So, to answer the question: CGGTAAC
The complimentary strand of MRNA would be AAUUCCGG.
taacgggtac
AATCGCCGTTA
The sequence would be GACGGT
The complementary strand for bases AAGCCA would be TTCGGT. In DNA, adenine pairs with thymine and guanine pairs with cytosine.
lol i hate this question........its in meh science book
3' aatgcccaggtcagtacgct 5' is the complimentary strand.
acg-att
A binds with T, G binds with C.Therefore the complementary strand for ATCGCATT would be TAGCGTAA.