answersLogoWhite

0

The complementary strand to GCCATTG would be CGGTAAC. Adenine pairs with thymine and guanine pairs with cytosine in DNA strands.

User Avatar

AnswerBot

1y ago

What else can I help you with?

Related Questions

The complimentary strand or matchig strand of DNA for tagtca would be?

It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.


DNA strand that would replicate tcgagaatctcgatt?

The complimentary DNA strand would be AGCTCTTAGAGCTAA.


If the sequence of nucleotides on one strand of a DNA molecule is gccattg the sequence on the complementry strand is?

G=C, G=C, T=A, A= T So, to answer the question: CGGTAAC


A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?

The complimentary strand of MRNA would be AAUUCCGG.


What is the complementary sequence of bases in the strand of DNA AACCCTGAGTCT?

taacgggtac


WHAT IS THE COMPLIMENTARY STRAND TO TTAGCGGCAAT?

AATCGCCGTTA


What would be the complimentary sequence of bases produced by a DNA strand with bases CTGCCA?

The sequence would be GACGGT


What are the bases on the complimentary strand of bases for strand with the bases AAGCCA?

The complementary strand for bases AAGCCA would be TTCGGT. In DNA, adenine pairs with thymine and guanine pairs with cytosine.


What is the complimentary strand for DNA for the sequence base of cttaggcttacca?

lol i hate this question........its in meh science book


What is the complementarty strand for 5' ttacgggtccagtcatgcga 3'?

3' aatgcccaggtcagtacgct 5' is the complimentary strand.


What is the complimentary strand of GTA-GCA?

acg-att


What would be the complimentary bases for a.t.c.g.c.a.t.t. for a dna strand?

A binds with T, G binds with C.Therefore the complementary strand for ATCGCATT would be TAGCGTAA.