0
What else can I help you with?
What is the complementary DNA strand template strand of atgccatgg?
The complimentary DNA strand to the template sequence atgccatgg is tacggtacc. This is because DNA bases always pair up in a specific way: adenine (A) with thymine (T) and cytosine (C) with guanine (G).
If the sequence of bases in one strand C-A-A-G-T what is the sequence of bases on the matching strand?
the complimentary styrand would be: T-C-C-G-A-T
What do the template strands of DNA always begin with?
DNA is made of of two complimentary strands, the coding strand and the template strand. When DNA is transcribed (made into messenger RNA which can be converted by ribosomes into proteins) the DNA splits open and free nucleotide bases bind to the template strand. DNA is made of T/C/G/A and RNA is made of U/C/G/A nucleotide bases. G and C bind (they are said to be 'complimentary') A and T bind and in RNA U and A bind (so U replaces T.) The newly formed RNA strand (made on the template stand of DNA) is 'complimentary' to the template but the same as the coding strand of DNA. Hence the template is used to produce RNA which is a copy of the coding strand. Either strand of DNA can act as the template/coding strand. Hope that is a little bit helpful!
When DNA replicates the new strand is what to the original strand?
The new strand is complementary to the original strand. This means that the bases on the new strand pair with the bases on the original strand according to the rules of base pairing (A with T and G with C).
If a DNA stand sequence tagcaagc what will be the complimentary strand?
The complementary strand to tagcaagc would be ATCGTTCG. In DNA, adenine (A) pairs with thymine (T), while cytosine (C) pairs with guanine (G). So, the complementary bases are matched accordingly to form the opposite strand.
What would be the complimentary sequence of bases produced by a DNA strand with bases CTGCCA?
The sequence would be GACGGT
What is the complementary sequence of bases in the strand of DNA AACCCTGAGTCT?
taacgggtac
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
What determines the sequence of the nitrogenous bases in a new DNA strand?
It's complimentary pair. C--G and T--A
What would be the complimentary bases for a.t.c.g.c.a.t.t. for a dna strand?
A binds with T, G binds with C.Therefore the complementary strand for ATCGCATT would be TAGCGTAA.
WHAT IS THE COMPLIMENTARY STRAND TO TTAGCGGCAAT?
AATCGCCGTTA
What is the complementarty strand for 5' ttacgggtccagtcatgcga 3'?
3' aatgcccaggtcagtacgct 5' is the complimentary strand.
The complimentary strand or matchig strand of DNA for tagtca would be?
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
What is the complimentary strand of GTA-GCA?
acg-att
DNA strand that would replicate tcgagaatctcgatt?
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
How does the pairing of the nitrogen bases in DNA molecule make sure that a replicated strand is exactly the same as the original strand?
The complimentary pairing of the two strands of DNA with their nitrogen-containing bases allows them to make exact copies. Each one matches up with another exactly to make the "blue print" of the cell.
What is the complementary DNA strand template strand of atgccatgg?
The complimentary DNA strand to the template sequence atgccatgg is tacggtacc. This is because DNA bases always pair up in a specific way: adenine (A) with thymine (T) and cytosine (C) with guanine (G).
